On July 16, 1969, the Apollo 11 spacecraft launched from Earth. Write out a program to simulate a one-minute launch countdown, starting from 60 and counting down to 1, followed by the word “LIFTOFF!!!”. You must import the time module to use its sleep function to make the countdown realistic: import time # This will make the computer wait for 1 second: time.sleep(1) The output must look like the following when you test your program: 60 59 58 … 3 2 1 LIFTOFF!!!
Q: Write a program in java to accept basicpay,hra, from the employee. Calculate grosspay which is…
A: Given:
Q: Create a program in python wages.py that assumes people are paid double time for hours over 60. They…
A: The required Python code is: import randomimport winsound hourRate=float(input("Enter the hourly…
Q: Write a program that will help an elementary school student learn multiplication. Use the…
A: #include <stdio.h>#include <stdlib.h>#include<time.h> //Random one digit positive…
Q: Create a new class called Simplecalc. In this class, implement a program that asks the user to enter…
A: // Java program for simple calculator import java.io.*;import java.lang.*;import…
Q: A supermarket needs to develop software to encourage regular customers. For this, the customer needs…
A: Solution: Given, A supermarket needs to develop software to encourage regular customers. For…
Q: Write a program in c ++ that inputs four numbers separated by spaces. The program should count how…
A:
Q: Write a program that generates a gradebook similar to the jenzabar grade book output: student name…
A: Note, as you haven't provided any programming language in the question so, I am using python…
Q: You are teaching a class and decide to curve the exam grades. Write a Java program that reads…
A: import java.util.*;class Test97 { public static void main(String args[]) { Scanner sc = new…
Q: Write a program in the Java code that modifies the function to test the number as follows: 2_If the…
A: The function toTest() ask user to enter a number which is then compared with the already initialised…
Q: A tic-tac-toe grid of size n is a grid composed of empty tiles bounded by solid lines. The grid is…
A: The following is the code with comments I tried to my best to comment as clear as possible.
Q: in java write a program to satisfy the a and b requirements: a). Write an operation class that can…
A: Introduction of Program: Java program gives three choices to the user, 1. Convert the temperature…
Q: Finish the Java program inputNewPlayerLocation: to input (x,y) coordinates from user (using…
A: Point is the built-in java class that is available to use in java.awt package The Point class…
Q: In python -Once upon a time in the Land of Apples, John had three apples, Mary had five apples,…
A: The description is as- Taking 3 variables juan, maria, adan and storing 3,5,6 apples respectively.…
Q: Design the Library and Book class so that the expected output is generated. #Write your code here…
A: Algorithm: Start Create a class Library with a class variable books which is a list and instance…
Q: Create a program which the final grade is calculated from an input like the image. So with use of…
A: According to the information given:- We have to calculate the average grade from where the final…
Q: USING TKinter Please create a Python program based on the game of WAR. The rules of the game are as…
A: WAR - game of cards War game of cards is a simple Card game in which each player flaps the cards.…
Q: tic-tac-toe grid of size n is a grid composed of empty tiles bounded by solid lines. The grid is…
A: In the following block I have pasted the code with comments. I request you to go through and run in…
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: Write a program that can be used by a small theater to sell tickets for performances. The theater’s…
A: Introduction: In this question, we have to write a program that asked for the prices of each seat of…
Q: Write a Python program that can convert a Fahrenheit temperature to Celsius, or vice versa. The…
A: Program code: filename: temps.py def c_to_f(tempCelsius): """ Function that converts…
Q: Write a program that will allow a student to compute for his equivalent semestral grade. • The…
A: The answer is given below.
Q: Implement the design of the Travel class in python so that the following output is produced: You…
A: Algorithm: Start Implement class Travel with a static variable count and class variables…
Q: Write a program to calculate total ordering cost. Jacob is a retailer for ice. Normally a bag of ice…
A: I give the code in python(because you have not mentioned any particular language) and also provide…
Q: Write a program that prompts the user for a U.S. dollar amount and then converts it to Japanese Yen,…
A: Please find the answer below :
Q: Modify the command-line argument example Hello.java, to handle a few command-line arguments. Ask the…
A: According to the Question below the Solution: Output:
Q: Can you write a new code in Java language with the values I sent you, just like this output? There…
A: Actually, c++ is a powerful general language. It is a high level language.
Q: THIS IS MEANT TO BE IN JAVA So far we've learned variables, branches, loops, and some array. The…
A: Here I have taken input from the user and stored it into a variable. Next, I have checked for the…
Q: Write a program that begins by reading a number of cents from the users as an integer (this is input…
A: In the Python 3 programming language, set all needed currency named variables to 0 to make floor…
Q: 3. A program that prints the power table for integers from 1 to 5. The table must include the…
A: public class Main{ public static void main(String[] args) { System.out.print("\t\t\t\t\tPower…
Q: Can you write a new code in Java language with the values I sent you, just like this output?…
A: Source code:- #include <bits/stdc++.h>using namespace std; int main(){ ifstream…
Q: Case 1: Input: 5.1, 5.1, 5.1, 5.1, 5.1. Expected Output: 26.
A: To program : The program should then add the five decimal numbers, convert the sum to the nearest…
Q: Write a python that calculates the position of a car moving in a 2D-plane given the list of…
A: To write the python program with the given description: Use a while loop, that will prompt the user…
Q: Develop a Java program using NetBeans , that initially display a menu to the user. The menu should…
A: Given: Develop a Java program using NetBeans , that initially display a menu to the user. The menu…
Q: Write a program in Java to generate the entire calendar for one year. The program must get two…
A: the program is given below:-
Q: Declare 4 integers variables as global, named: EvenNum, EvenSum, OddNum, OddSum and initialize them…
A: Use a loop to accept input and we follow loop as long as the input is non-negative
Q: java You must print the number declared double x; on the screen. With which of the following…
A: Format specifiers begin with a percent sign (%) and end with a converter. Since x is of type double,…
Q: write in JAVA LANGUAGE Create a program that will compute PRELIM, MID-TERM, PRE-FINAL, FINALS GRADES…
A: Task : Collect the 3 quiz marks in Prelim Midterm Pre-Finals Finals Output the list of grades…
Q: 1. Write a program that reads a Celsius degree in a double value from the console, then converts it…
A: Begin Take the celcius double value as input Compute the farhenheit Print value End
Q: Write a program that computes the fuel efficiency of a multi-leg journey. The program will first…
A: We need to write a Python program for given scenario.
Q: Write a program that creates a table for the user's choice of basic math operations (+, -, *, /, and…
A: def addition(): x = getsize() print("\n+ | ",end=' ') for i inrange(1,x+1): print(i,end=' ')…
Q: A python program that lets the user play the game of Rock, Paper, Scissors against the computer. The…
A: import random random.seed(300) def determineWinner(playerChoice, computerChoice): # Checking…
Q: For this assignment, write a program called Payday.java that will compute and print a person's…
A: Given:
Q: reate a java program that calculates the average test scores. Three employees in a company are ups…
A: Create a java program that calculates the average test scores. Three employees in a company are ups…
Q: I am stuck trying to create a program in PYTHON that calculates the coins needed to make change for…
A: Answer: I have done code and also I have attached code
Q: Write a Python program which computes win/loss record, average score and average point spread of a…
A: your_team=input("Enter the your team name: ")opponent_team=input("Enter the name of your opponent…
Q: Write an application in Python that allows a user to play the game Bulls and Cows against a…
A: Lets see the solution.
Q: Write a java program to find how much time required to execute a function which only have a print…
A: Algorithm: Start Implement a method display() with one print statement In the main method, create…
Q: Suppose you save $100 each month into a savings account with the annual interest rate 5%. So, the…
A: Lets see the solution.
Q: Create a java program that calculates the average test scores. Three employees in a company are ups…
A: Java Code: import java.io.BufferedWriter; import java.io.File; import java.io.FileWriter; import…
Q: Write a program that begins by reading a number of cents from the users as an integer (this is input…
A: Initialize all required currency named variable with 0 in python3 programming language so that the…
Q: For this assignment, write a program called Payday.java that will compute and print a person's…
A: Required: For this assignment, write a program called Payday.java that will compute and print a…
Q: Write program that can be used by a small theater to sell tickets for performances. The theater's…
A: Solution: Given, program that can be used by a small theater to sell tickets for performances.…
Q: You are asked to write a java program for an embassy to help with the visa process. Your program…
A: I give the code in Java along with output and code screenshot
Q: The Research team led by Bernadette Wolowitz at Cal-tech University has discovered a new Amoeba that…
A: Explanation: Include all the necessary header files. Declare the necessary variables. Take the user…
Q: Write a python program for a pig game that has two players that alternate turns rolling dice. In…
A:
On July 16, 1969, the Apollo 11 spacecraft launched from Earth. Write out a
You must import the time module to use its sleep function to make the countdown realistic:
import time
# This will make the computer wait for 1 second:
time.sleep(1)
The output must look like the following when you test your program:
60
59
58
…
3
2
1
LIFTOFF!!!
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 3 images
- java You must print the number declared double x; on the screen. With which of the following options do you know that a number in the range -9999.99999 to 9999.99999 is printed with exactly 4 decimals and that all numbers in the number are displayed? Choose an alternative: a.System.out.format ("%. 4f", x); b.System.out.format ("% 4.1f", x); c.System.out.format ("% b", x); d.System.out.format ("% s", x); e.System.out.format ("% d", x);Write a program that allows a player to play Rock, Paper, and Scissors against the computer. In this version, if there is a tie the computer wins. The user must beat the computer to win around.The player will provide their name and the number of rounds they want to play. They will begin by entering their name and the number of rounds they would like to play. For each round, the player will input a character to represent their play (‘R’ for rock, ‘P’ for paper, or ‘S’ for scissors). The program will randomly select its play and output whether the player won or lost. After all, rounds have been completed the program will output the match-winner. In the case that the player wins the match, it will output their percentage of wins otherwise it will output the percentage of losses. Use the following functions / descriptions for your code. You may (should) add more functions as you deem necessary, but you may not omit or modify the functionality described below (Don’t forget you will also…Modify the command-line argument example Hello.java, to handle a few command-line arguments. Ask the user to enter a name followed by a number. The program should print out the name N times, while N is the input number. For example, if the command-line input is Java Hello Jim R. Joseph 5 Then the output should be: Jim R. JosephJim R. JosephJim R. JosephJim R. JosephJim R. Joseph
- In python Programming, Suppose you have four dogs named Leo, Tom, Jerry, and Jack, and four dog food bowls labeled 1, 2, 3, and 4. Each bowl can hold up to sixteen scoops of food and each dog chooses a separate bowl, but it doesn't matter which dog uses which bowl. For their dinner each day, you distribute sixteen scoops of dog food into the bowls, so each bowl will receive a whole number units of food. You are pretty careless, and you sometimes leave some bowls empty. If you always put out the full sixteen units of food each day, how many ways can you distribute the food among the four bowls?Write a program MathOperations.java that will read in command-line argument (assumed to be a number, and not just an integer), and 1. convert the command-line value into a double; 2. store this value into a variable x; 3. use x and Math library to output the result of several mathematical operations, as shown below. Note on using Math library: Math.sqrt(x) returns square root of x. Math.pow(x,2.5) returns x raised to the power 2.5. Math.abs(x) returns an absolute value of x. Math.cos(x) returns cosine of x (in radians). What should your program print out? For example, if your command-line value is 3.14, your program should output the following: Your number is 3.14 ------------------- 3.14 squared = 9.8596 3.14 cubed = 30.959144000000002 square root of 3.14 = 1.772004514666935 3.14 raised to the power 0.5 = 1.772004514666935 The absolute value of 3.14 = 3.14 cosine of 3.14 (in radians) = -0.999998731727539 Or if your input argument is 16, your program should output the following: Your…Create a program that takes in a student’s full names and marks for 3 In-class exercises, then calculate the average of this marks. This average mark is then categorized as follows: Marks obtained Grade Level Message 80 – 100 1 Magnificent!! 70 – 79 2 Excellent!! 60 – 69 3 Good work!! 50 – 59 4 Good!! 0 – 49 0 Fail – Try again next Year!! Greater than 100 or less than 0 X Invalid Marks!!, Marks too high. Or Invalid Marks!!, Negative marks not allowed. Sample run 1: Enter student full names: Goodluck Johnathan Enter 3 marks separated by spaces: 78 94.6 88 Output: Student name: Goodluck Johnathan Grade Level: 1 Comment: Magnificent!! Sample run 2: Enter student full names: Ellen Johnson Sirleaf Enter 3 marks separated by spaces: 200 104.87 99.9…
- In PyCharm, write a program that prompts the user for their name and age. Your program should then tell the user the year they were born. Here is a sample execution of the program with the user input in bold: What is your name? Amanda How old are you? 15 Hello Amanda! You were born in 2005 import datetimename = input("What is your name? ")age = int(input("How old are you? "))year = datetime.datetime.now().yearprint("Hello " +name + " you were born in "+str((year-age))) this is my code but it is only displaying in PyCharm "what is your name?" I feel something is wrongWrite a program that can be used to calculate the federal tax. The tax is calculated as follows: For single people, the standard exemption is $4,000; for married people, the standard exemption is $7,000. A person can also put up to 6% of his or her gross income in a pension plan. The tax rates are as follows: If the taxable income is: Between $0 and $15,000, the tax rate is 15%. Between $15,001 and $40,000, the tax is $2,250 plus 25% of the taxable income over $15,000. Over $40,000, the tax is $8,460 plus 35% of the taxable income over $40,000. Prompt the user to enter the following information: Marital status If the marital status is “married,” ask for the number of children under the age of 14 Gross salary (If the marital status is “married” and both spouses have income, enter the combined salary.) Percentage of gross income contributed to a pension fund Your program must consist of at least the following functions: Function getData: This function asks the user to enter the…Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For single people, the standard exemption is $4,000; for married people, the standard exemption is $7,000. A person can also put up to 6% of his or her gross income in a pension plan. The tax rates are as follows: If the taxable income is: Between $0 and $15,000, the tax rate is 15%. Between $15,001 and $40,000, the tax is $2,250 plus 25% of the taxable income over $15,000. Over $40,000, the tax is $8,460 plus 35% of the taxable income over $40,000. Prompt the user to enter the following information: Marital status If the marital status is “married,” ask for the number of children under the age of 14 Gross salary (If the marital status is “married” and both spouses have income, enter the combined salary.) Percentage of gross income contributed to a pension fund
- Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For single people, the standard exemption is $4,000; for married people, the standard exemption is $7,000. A person can also put up to 6% of his or her gross income in a pension plan. The tax rates are as follows: If the taxable income is: Between $0 and $15,000, the tax rate is 15%. Between $15,001 and $40,000, the tax is $2,250 plus 25% of the taxable income over $15,000. Over $40,000, the tax is $8,460 plus 35% of the taxable income over $40,000. Prompt the user to enter the following information: Marital status If the marital status is “married,” ask for the number of children under the age of 14 Gross salary (If the marital status is “married” and both spouses have income, enter the combined salary.) Percentage of gross income contributed to a pension fund Your program must consist of at least the following functions: Function getData: This function asks the user to…Implement the design of the Travel class in python so that the following output is produced: You are not allowed to change the code below # Write your code hereprint(“No. of Traveller =”, Travel.count)print("=======================")t1 = Travel("Dhaka","India")print(t1.display_travel_info())print("=======================")t2 = Travel("Kuala Lampur","Dhaka")t2.set_time(23)print(t2.display_travel_info())print("=======================")t3 = Travel("Dhaka","New_Zealand")t3.set_time(15)t3.set_destination("Germany")print(t3.display_travel_info())print("=======================")t4 = Travel("Dhaka","India")t4.set_time(9)t4.set_source("Malaysia")t4.set_destination("Canada")print(t4.display_travel_info())print("=======================")print(“No. of Traveller =”, Travel.count) output: No. of Traveller = 0=======================Source: DhakaDestination:IndiaFlight Time:1:00=======================Source: Kuala LampurDestination:DhakaFlight Time:23:00=======================Source:…Create a java program that calculates the average test scores. Three employees in a company are ups for a special pay increase. You are given a file; ABCompany.txt, with the following data: Miller Andrew 65789.87 5 Green Sheila 75892.56 6 Sethi Amit 74900.50 6.1 Each input line consists of an employee’s last name, first name. Current salary and percent pay increase. For example, in the first input line, the last name of the employee is Miller, the first name is Andrew, the current salary is 65789.87 and the pay increase is 5%. Write a program that reads the data from the specified file and stores the output in the file ABCoutput.dat. For each employee, the data must be output in the following form: firstname lastname updated salary. Format the output of decimal numbers to two decimal places. Send a copy of the following: the java code Screenshot of the results screenshot of input file screenshot of output file