One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles in many functions. Which of the following is NOT the function of NADPH? O a. ROS detoxification O b. O C. O d. O e. Biosynthesis of fatty acids Translation Biosynthesis of cholesterol Drug metabolism
Q: LO 53- Determine the type of mutations based on the effect in the amino acid chain "missense,…
A: Missense, non-sense and silent mutation are the types of point mutation. In point mutation, one base…
Q: In the ß-oxidation pathway, the oxidation occurs at carbon [Select] acetyl group that becomes…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 1 which parts of amino acids are involved in tertiary structures ? 2 polar side chain can make…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Which of the following occurs during the second round of the Q cycle (oxidized coenzyme Q =…
A: The Q cycle shows the sequential oxidation and reduction of CoQ, between the ubiquinol and…
Q: Positive and negative controls must be included in any immunoassay. Controls are always run before…
A: A variable is any quantity we can measure. In any experiment there are three variables:…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: xplain the answer to this following question. Why does linolenic acid have the lowest melting point?…
A: Fatty acids (FA) are simplest lipids which is comprised of carboxylic acid with long hydrocarbon…
Q: Explain the importance of solubility in drug product formulation. 2.
A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…
Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…
A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: 31) There are several modes for enzyme regulation. What's the difference between competitive and…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Given this peptide chain: LYS – MET – ASP – THR – GLN – ARG- LYS – TRP – MET – LYS – GLU – VAL- ARG…
A: Using chromatography, a compound can be separated from a mixture of compounds. There can be various…
Q: Which of the following is CORRECT?
A: In the reaction of Glycolysis, the △G values of the three irreversible reactions are : Glucose +…
Q: Does the complete oxidation of tridecanoic acid (C13:0) make more ATP than the complete oxidation of…
A: Triacylglycerols are stored form of lipids in the body. When there is a lack of energy and…
Q: 5) The nucleotides in the backbone of DNA are held together by bonds. A) hydrogen B) peptide…
A: Nucleic acids are composed of nucleotides (sugar, nitrogenous base & phosphate group). Nucleic…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: To which part of DNA do the eukaryotic transcription factors bind? O a. promoter regions O b.…
A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…
Q: Following data were obtained in a study of enzymatic reaction that follows the Michaelis Menten…
A: 1. Km is the substrate concentration at which the Vmax is half. Km (concentration of substrate) =…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: if we are able to recreate or stimulate telomerase, could humans potentially live forever?”
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Classification of lipids.
A: A category of heterogeneous chemical substances that are soluble in non-polar solvents are referred…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: Which of these chemicals damages the brain in a way that resembles Parkinson’s disease? A. Capsaicin…
A: Dopamine is a neurotransmitter. It is synthesised by dopaminergic neurons. Parkinson's disease is…
Q: The class of enzymes that cleaves most aromatic rings in biological systems is _____________.…
A: Enzymes are proteins that interact with substrate molecules to stabilise the transition state and…
Q: 1. Scheme of aerobic oxidation of glucose and energy balance.
A: Aerobic oxidation of glucose is also called cellular respiration. Cellular respiration is a…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to…
A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It takes…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: Given a peptide chain that is composed of the following amino acids: (branched chain-- polar…
A: Chromatography is a separation technique by which amino acids dissolved in a mobile phase are…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Which of the following interactions would be seen between the R-groups of His and Gln at pH 8?…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: What shuttle mechanism transfers the electrons from cytosolic NADH into the mitochondria with the…
A: Mitochondrial inner membrane is impermeable to NADH. Hence, for transfer of NADH, it is first…
Q: Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP: the energy…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: human cannot digest stachyose. Why？isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: Provide 3 reactions that facilitate the synthesis of oxaloacetate
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: Please check all the proteins that would likely have a nuclear localization sequence: Histones TATA…
A: The nuclear localisation sequence(NLS) is the amino acid sequence that marks a protein for import…
Step by step
Solved in 2 steps
- Beta oxidation is ______. a. the breakdown of sugars b. the assembly of sugars c. the breakdown of fatty acids d. the removal of amino groups from amino acidsWhich of the following reactions is the most exergonic? a Conversion of PEP to Pyruvate b Conversion of Glucose-6-phosphate to Glucose c All of the reactions are equally exergonic. d Hydrolysis of ATPWhich of the following statements concerning the location of the metabolic pathways is correct? a. All reactions of the glycolysis take place in the mitochondria. b. All reactions of the TCA cycle take place in the mitochondria. c. Some reactions of the TCA cycle take place in the cytosol, and some in mitochondria. d. Some reactions of the glycolysis take place in the cytosol, and some in mitochondria.
- The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. b. provide intermediates for the citric acid cycle c. participate in oxidation-reduction reactions during the formation of H,O d. act as a source of ADP for biosynthesisWhich of the following statements is CORRECT regarding the pentose phosphate pathway? a. It has two reactions that produce NADPH in its oxidative phase. b. The pentose phosphate pathway is also called hexose diphosphate shunt. c. The pathway generates FADH2. d. NAPH is produced in the non-oxidative phase of the pathway.How many NADPH and ATP are used in the synthesis of the C16:0 fatty acid starting from acetyl-CoA and bicarbonate? A. 7 NADPH, 7 ATP B. 8 NADPH, 8 ATP C. 14 NADPH, 7 ATP D. 16 NADPH, 8 ATP E. 14 NADPH, 8 ATP
- Which of the following is NOT TRUE about fatty acid biosynthesis? A. 8 NADPH is used to produce palmitate. B. The growing fatty acid chain is elongated by the sequential addition of two-carbon units. C. The process is repeated 7 times to produce palmitate. D. The process occurs in the cytosol.Two Acetyl-coA molecules released from a fatty acid enter the Krebs cycle, and can produce six NADH molecules and two FADH2 molecules. These reduced coenzymes can be used to generate: a) 28 ATP b) 22 ATP c) 12 ATP d) 6 ATP e) 4 net ATPWhich of the given process does not occur in mitochondria? a.Formation of acetyl CoA b.Oxidation of NADH + Ht c.Citric acid formation d.Conversion of pyruvic acid to acetaldehyde
- Which of the following can undergo metabolic conversion to acetyl CoA and enter the citric acid cycle? A. Fatty acids B. All of the choices are correct. C. Protein D. GlucoseCHOOSE THE CORRECT LETTER A new metabolic enzyme which utilizes NAD* as a coenzyme. Which of the following could be TRUE based on this information?A. It is involved in an anabolic pathway.B. It performs acetyl group transfer.C. It is involved in a catabolic pathway.D.It catalyzes a hydrolytic cleavage.What happens during glycolysis, the first stage of cellular respiration? A. Glucose is broken down gradually via several enzyme-controlled steps. B. All of these C. A small amount of ATP is produced D. NADH, an electron carrier is produced E. Glucose is split to form two molecules of pyruvate