Which of the following reactions is the most exergonic? a Conversion of PEP to Pyruvate b Conversion of Glucose-6-phosphate to Glucose c All of the reactions are equally exergonic. d Hydrolysis of ATP

Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…

A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…

Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…

A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…

Q: Transport of lipids in blood involve lipoproteins which includes the LDL and HDL commonly referred…

A: Lipoproteins carry fats in the bloodstream. Lipoproteins are made up of an inner core of hydrophobic…

Q: importance of nutrition

A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…

Q: 5. Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins?…

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…

Q: The Human genome project used the following methods Shotgun Sanger Both None

A: The Human Genome Project : It was an international  effort to find the DNA sequence of the complete…

Q: Solve the following problems using the basic assumptions:  1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP…

A: When there is no carbohydrates available in the body, the fatty acids undergo β-oxidation to yield…

Q: The most regulated enzyme in glycolysis is a   Hexokinase b   G3P Dehydrogenase c   Pyruvate…

A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…

Q: How does ground state destabilization, transition state stabilization, and proximity lead to…

A: Enzymes are protein molecules that speed up the biochemical reactions by decreasing the activation…

Q: 1. Search for a journal article about a certain drug that targets (whether stimulate or block) a…

A: a) Cystic Fibrosis is a genetic disorder caused by mutations in the gene encoding for CFTR i.e…

Q: What is the ATPase

A: Adenosine triphosphate (ATP)ases are a class of enzymes that catalyse the hydrolysis of a phosphate…

Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above

A: Promoter : the sequence that are important in the initiation of transcription of a transcription…

Q: Which of the following statements are TRUE?   Multiple answers:Multiple answers are accepted for…

A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…

Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…

A: Two answers are correct

Q: What are other staining methods that can be used for PAGE?

A: Introduction: PAGE electrophoresis is a subtype of gel electrophoresis whereby normal gel is…

Q: According to the Arrenhius theory, an acid is:   a. a substance that forms hydroxide ions   b. a…

A: Arrhenius theory gives us the concept of acid and base. This theory is given based on the…

Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…

A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…

Q: Name of complex Electron donor No. of H+ ions pumped (NADH/FADH2) 1. 5. 7. 2. 6. 8. 3. 9. 4. 10.

A: The electron transport chain occurs in the mitochondria. There are four electron transport chain…

Q: 8. Which of the following takes place due to phosphorylation of isocitrate dehydrogenase? a)…

A: Isocitrate dehydrogenase is effectively recognized as a key factor in the Krebs cycle, where it…

Q: What does blood typing detect?       presence of surface feature molecules in the blood anti-sera…

A: Using the method blood typing, the universal ABO blood group system has been established.

Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…

A: The DNA replication in the newly added base are read by DNA pol I  enzyme to check weather the added…

Q: What is the process in which antibodies attach to antigens, causing the formation of masses of…

A: Because the Y-shaped antibody arms randomly attach to many surfaces of non-self red blood cells,…

Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…

A: The equation for the oxidation of glucose is:

Q: Polyadenylation signal sequence is present in Termination region 3'UTR O Poly(A) tail All of the…

A: In eukaryotes the process of polyadenylation involves the addition of a poly(A) tail to a mRNA…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Match the blood glucose source with its fate/outcome.…

A: Blood sugar which is also known as glucose is described as one of the crucial as well as major sugar…

Q: TRUE or FALSE: Lipids may originate through carbocation-based condensation of thioesters or by…

A: Introduction: Lipids are a heterogeneous group of biomolecules that includes fats, oils, waxes,…

Q: Sample pH vs Initial Velocity (AA450/60 seconds) a bo16 0.0014 al0012 0.0008 0.0006 0.0004 0.0002 pH…

A: Enzymes are biological catalysts that are capable of catalysing a reaction by binding to Substrate.…

Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…

A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…

Q: Complete the table below by supplying AT LEAST ONE example of a monomer with its polymer for each…

A: Lipids are hydrophobic or hydrophilic bio macromolecules which can be of several types like fatty…

Q: Restriction digestion of DNA fragments is not sequence specific. True False

A: Within a few years after discovering EcoB, EcoK, and HindII, scientists were already experimenting…

Q: explain the relationship between glycogen metabolism,  the pentose phosphate shunt, dyslipidemia,…

A: Glycogen metabolism is the glycogenolysis or breakdown of glycogen during fasting and muscle…

Q: Name the complexes of the ETC, electron donor, and determine the number of H+ ions that are pumped…

A: Electron transport chain and chemiosmosis are part of oxidative phosphorylation.  Oxidative…

Q: citric acid cycle

A: Citric acid cycle is one of the pathway of the carbohydrate metabolism which is also known as the…

Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…

A: Amylopectin and glucogen are examples of branched polysaccharides.

Q: Describe the properties of water that are critical to maintaining life Include a discussion of…

A: Water most important element on earth without that life on earth can not be possible , without water…

Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…

A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.

Q: Golden rice is genetically modified to express the following

A: Golden rice is one of the genetically modified variety of rice.

Q: 3. Draw the chemical structure of cholesterol and state its functions 4. Explain in detail the…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Which of the following is the correct order of mechanism of how sugar is perceived?   Signal…

A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…

Q: Human hemoglobin as a tetrameric protein of about 64.5KDa consists of 2 beta chains. Calculate the…

A: Hemoglobin : It is a iron containing metalloprotein found in red blood cells . Hemoglobin in the…

Q: 1.Explain how dietary lipids are absorbed by the human body.

A:

Q: The Lineweaver-Burke plots of a reaction without inhibitor and one with non-competitive inhibitor…

A: Enzymes are catalysts that enhance the rate of biochemical reactions.

Q: Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? • What happens to…

A: The gastric juice comprises of water, mucus, hydrochloric acid, pepsin, and intrinsic factor and…

Q: Question 21 Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the…

A: Transcription is the process that occurs in nucleus of a cell that involves the Synthesis of mRNA…

Q: 1. Shown below is a metabolic pathway: Es E4, E F > E1 E3 A - B C - D E2 E6 R E7 Es Suppose we have…

A: Note : Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: amino acids as precursors

A: Amino acids acts a precursor pf many other nitrogen containing compounds which are Porphyrines,…

Q: Where is the labeled carbomn found when the folliowing molecules are added to a cell carrying out…

A: Palmitate synthase is the enzyme complex that synthesizes the 16 carbon long saturated fatty acid…

Q: Describe the β-oxidation of the fatty acid palmitate

A: Beta oxidation in biochemistry and metabolism is a catabolic process through which fatty acids…

Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…

A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…