ou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT       a. mycobacterium b.some kind of fungus c. steptococcus species d.nocardia

Q: Bacteria and human beings are very different organisms. Why is it possible to combine their DNA and…

A: Bacteria are unicellular prokaryotes, having a peptidoglycan cell wall and a multi-component…

Q: Which of the following is true about plasmids?a) They are present in all organismsb) They are…

A: A plasmid is circular, extrachromosomal, small piece of DNA present in the cytoplasm that is…

Q: What was the key finding from Griffith’s experiments using live and heat-killed pathogenic bacteria?…

A: Answer is d.)  genetic material can be transferred from dead to live bacteria.

Q: Scientists have used genetic technology to develop strains of bacteria that are especially suited…

A: Bioremediation Is A Method Of Treating Contaminated Media, Such As Water, Soil, And Subterranean…

Q: Cell membrane proteins are determined by  A. Polymerase chain reaction (PCR) B. Thin layer…

A: The biological membrane mainly consists of a lipid bilayer and protein. They form an essential…

Q: Match the Scientists to their Discoveries v Said A=T and C=G in an organism A. Franklin and Wilkins…

A: Many scientists have worked and given theories or discoveries.  The first statement says about the…

Q: Your biology lab instructor gives you a petri dish of agar covered with visible colonies. Your lab…

A: Bacteria are the prokaryotes that lack the well-defined nucleus.

Q: Choose the best below ? The RNA-first hypothesis for the origin of cells is supported by…

A: The central role for various proteins in a cell is chemical reaction catalyzes that are important…

Q: Restriction enzymes. A. are molecular "scisos" thatcut at precise DNA sequences B. can…

A: ANSWER) (E) all of the above Restriction enzymes: are molecular scissors that cut precise DNA…

Q: Alfred Hershey and Martha Chase performed experiments to show that A: the genetic material was DNA…

A: DNA is the organic molecule that carries information from one generation to another. Several…

Q: Plasmids are circular extrachromosomal DNA in bacteria that play a role in:       d. degradation…

A: Plasmids are extrachromosomal circular DNA inserted within bacteria which provide certain advantage…

Q: You mix a culture of killed ampicillin-resistant Staphylococcus bacteria with some live E. coli…

A: Recombination in bacteria: a. The term recombination refers to the exchange of genetic material…

Q: Bacteria are able to successfully transcribe and translate humangenes becausea. both bacteria and…

A: Answer is b.) bacteria can replicate their DNA ,but humans cannot.

Q: A virologist is trying to make a new antiretroviral drug to treat HIV. In order to do so with the…

A: Human immunodeficiency virus ( HIV ) is an infectious disease which is affecting the immune system…

Q: Imagine that there is an E. coli outbreak in your area, and you would like to test the kangkong from…

A: E coli or Escherichia coli is basically a bacterium commonly found in lower intestine of warm…

Q: RNA is believed to be the first functional macromolecule in protobiontsbecause ita. is easier to…

A: Rna the ribose nucleic acid consist of a ribose sugar and phosphate and nitrogenous base.it is the…

Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…

A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…

Q: 7. Which best describes molecule A? a. It is an insulin gene. b. It is recombinant DNA. c. It is a…

A: Bacteria also called microbes are prokaryotic organisms that are minute and observed with a…

Q: DNA is directly passed from one live microbial cell to another in the process of ?   A.…

A: Sexual reproduction in bacteria is different from the sexual reproduction in eukaryotic organisms.…

Q: Radiation kills bacteria through. O A. inducing DNA fragmentation O B. inducing drought conditions O…

A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than…

Q: A bacterium can naturally uptake DNA from environment. This is because, The bacterium contains…

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: Frederick Griffith documented bacterial transformation. Which statement is true concerning his…

A: Bacterial transformation is the process of horizontal gene transfer through which some bacteria…

Q: Which of the following characteristics is not true of a plasmid?a. It is a circular piece of DNA.b.…

A: Deoxyribonucleic acid (DNA) is a long molecule. Deoxyribonucleic acid is composed of two…

Q: Which process is most likely to result in a gene providing antibiotic resistance being found in a…

A: C. Transduction

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: For a living organism, the cell is considered the basic fundamental unit of life. Organisms can be…

Q: Which would be most useful in the process of lysing a bacterium so that it's DNA could be collected…

A: Cell Lysis  It is the process of rupturing the membrane or walls of a cell.

Q: The accompanying figure illustrates the portion(s) of a typical bacterial or archaeal genome that…

A: Bacteria are microscopic organisms which belong to prokaryote because these are unicellular…

Q: In its organization, chloroplast DNA is most similar to a. bacteria. b. archaea. c. nuclear DNA of…

A: The chloroplast is the cell organelle found in plant cells. They have chlorophyll and help the plant…

Q: Griffith discovered a “transforming factor” in bacteria that conveyed infectiousness in 1928. In…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: A small nonessential circular DNA molecule in prokaryotes is called a: a. plasmid b. telomere c.…

A: Prokaryotes are the unicellular organism that belonged to the bacteria or archaea domain, these are…

Q: Bacteriophages kill their host quickly by____ . a. binary fission c. a lysogenic pathway b. a lytic…

A: Bacteriophages are viruses that use bacterial cells as hosts.

Q: 10. You have a blood stain and want to match it to a large number of blood samples. only a minute…

A: A microscope is a scientific tool that is used to study items which are too small for the naked eye…

Q: In lytic cycle of bacteriophage replication a. bacteriophage transfers bacterial DNA b. viral DNA…

A: The viral particles are obligate parasites. They lack the cell machinery required for propagation or…

Q: How is Archae more closely related to Eukarya than to bacteria even though Arche and bacteria are…

A: Archae are microorganisms that are similar in size and form to bacteria but are vastly different in…

Q: Which of the following is not a process to introduce a DNA molecule into a bacterial cell. a)…

A: To identify Which of the following is not a process to introduce a DNA molecule into a bacterial…

Q: Describe the strange thing that scientists found in E. coli's bacterial genome.

A: E.Coli is a gram-negative bacteria ,It has a circular double stranded DNA.

Q: 2. DNA is coiled & condensed into chromosomes so it can A. be packed into a small, organized space…

A: NOTE: Since you have asked multiple questions, we will solve the first question for you. If you want…

Q: A new, highly antibiotic resistant strain of bacteria contains a small, circular, segment of…

A: Some of the bacteria have double-stranded DNA as their genetic material and they also contain other…

Q: Match the terms appropriately.___ bacteriophage                a. nitrogen-containing base,___ clone…

A: Nucleic acid is the polymer of nucleotides. There are two types of nitrogenous bases in DNA: purines…

Q: If a police detective finds the tiniest amount of cells at a crime scene, they could produce more…

A: Polymerase chain reaction Hence option(b) is correct.

Q: Define the following terms: a. molecular biology b. genetics c. replication d. transcription e.…

A: The Central Dogma is the process of converting the genetic molecule into functional products where…

Q: Which process of DNA transfer in bacteria requires a virus? a. Conjugation b. Transduction c.…

A: Bacteria exchange the genetic material through three different mechanisms. It includes transduction,…

Q: In the "DNA Extraction from Fruit" laboratory, DNA from a banana, kiwi or strawberry was extracted.…

A: DNA Or deoxyribonucleic acid is the common biomolecule present in living things, that is responsible…

Q: Salted Pork and Salted Fish can be stored at room temperature for many months without spoilage…

A: The term food preservation refers to any one of a number of techniques used to prevent food from…

Q: _________5. It is a eukaryotic cells that contains also plasmids and use to produce  desirable…

A: A plasmid is a small extra chromosomal DNA molecule in a cell which is physically separated from the…

Q: A scientist studying the sequence of nucleotides in the rRNA of a bacterial species is working on…

A: Ribosomal RNA sequences differ between species, due to the mutations. Through variation in the rRNA…

Q: A scientist isolates the DNA genome from a virus. She attempts to carry out a melting analysis but…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Viruses frequently infect bacteria and insert new genes into the genetic material of the bacteria.…

A: Viruses are intracellular, obligate parasites that contain either deoxyribonucleic acid (DNA) or…

Q: When you have a recombinant organism, it generally has genetic information from a. only an archaea…

A: Recombinant technology Recombinant technology is an emerging field involving the production of…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.