Answered: Peptidoglycan tail is made of…

Peptidoglycan tail is made of sterioisomers of amino acids to minimise helix formation Group of answer choices True False

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter22: Prokaryotes: Bacteria And Archaea

Section: Chapter Questions

Problem 14RQ: Pseudopeptidoglycan is a characteristic of the walls of. eukaryotic cells bacterial prokaryotic...

See similar textbooks

Related questions

Q: 15. Which of the following glycans can be released from proteins using BB- elimination? a. Complex…

A: Note: We are authorized to answer one question at a time since you have not mentioned which question…

Q: Each of the following statements concerning penicillin is correct EXCEPT: a. Penicillin is a…

A: Introduction: penicillin is an antibiotic that is obtained from Penicillium chrysogenum and…

Q: 1-. Enumerate the elemental composition of the following biomolecules. (16 – 20) 16. tryptophan 17.…

A: Tryptophan is a hydrophobic amino acid with an indole side chain. Tryptophan shows high absorbance…

Q: Draw 9:51 am / Draw 9:51 am / -u deleted this message 9:51 am What are the Amino acids and the…

A: Amino acids are biomolecules that are composed of an alpha carbon bonded to 4 groups. They are; a…

Q: 40. In peptidoglycan structure, the 3rd amino acid is connected to 3rd amino acid of the adjacent…

A: Also known as murein. Peptidoglycan has a polymer-like structure with sugars and amino acids. It…

Q: The common amino acid residues in B-turis are proline and lysine

A: Proteins are the polymers of amino acids. There are four levels of structural organizations for the…

Q: One section of lactoferrin contains the amino acid sequence shown below. Arginine – Serine –…

A: Codon - It is a series of 3 nucleotides that code for specific amino acid in the process of protein…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: P04: all of the following are aromatic amino acids except-- a. Phenylalanine b. Tyrosine c.…

A: Amino acids are composed of amino group which is present on left side and acid group which is…

Q: 1) Therapeutic proteins such as human insulin are produced on a large scale in E. coli, however the…

A: Therapeutic insulin is produced as a result of heterologous gene expression in E. coli. E. coli is a…

Q: 19. Which of the following nitrogenous bases are classified as pyrimidines? Group of answer choices…

A: ans is CYTOSINE and THYMINE.

Q: Draw the dinucleotide AT and label the following: 5’ and 3’ ends Phosphodiester bond…

A: Adenine (A) and Thymine (T) both are Nucleotides bases. Adenine is a Purine base and Thymine is…

Q: 8. One amino acid contains a guanidino group. What is the approximate pka of the weak base in the…

A: Amino acids are organic compound having two functional group namely carboxyl and amino. An amino…

Q: 0. The process used to join two molecules of nucleic acid together (or any two organic molecules,…

A: Two simple substances are called monomers.

Q: 10. Which of the following is a purely ketogenic amino acid? A. Tyrosine B. Leucine

A: Ketogenic amino acids are the amino acids that can be converted directly to acetyl CoA, which is…

Q: Draw the form of histidine (pl = 7.6) that predominates at (i)pH = 7.6 (ii)pH = 10.5 (ii)pH= 5.0

A: Peptides and proteins are the linear chain of amino acids attached via peptide bonds. All-natural…

Q: 9. Sulfur containing amino acid is: a. Cysteine b. Leucine

A: Amino acids are building blocks of protein which is made up of an amino group, carboxyl group and an…

Q: The process of creating a polysaccharide can be referred to as: Question 18 options:…

A: Introduction :- The most prevalent carbohydrates in diet are polysaccharides, often known as…

Q: How can ribosomes cause problems in treacher collins Syndrome? Please write it in a…

A: Treacher collin syndrome is defined as the state of genetic disorder in which the facial bones are…

Q: he compound shown below is NH2 HC CH -O-P-0-CH н н H H OH H thymidine monophosphate. a nucleotide.…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Stapphylococcus aureus V8 protease cleaves at the C-termini of Asp and Glu. How many fragments do…

A: Protein is a sequence of amino acid which are joined by peptide bonds.

Q: peptidyl transferase enzyme activity forms A- peptide bonds between nucleotides B-peptide bonds…

A: Proteins are 3D structures that are stable and functional formed by one or more polypeptide chains.…

Q: I would like a explanation or flow of information about the Central Dogma. Include describing the…

A: Central dogma The biological information flows through genes. DNA is the main genetic material of…

Q: What is the Amino Acid Sequence of 3'-AUG GUA CUC UUA ACA CCA GUG GAA AAA-5'

A: Proteins are polymers made of amino acids. The cellular process by which proteins are synthesized by…

Q: Which of the following does not belong to the group? Group of answer choices maltose lactose…

A: Carbohydrates are sugars molecules which can be simple sugars like glucose and be a group of the…

Q: Average net charge of +2 predominates: а. b. The predominant species is…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify…

A: Studies on the interactions between chemicals and nucleic acids are important because they can be…

Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…

A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…

Q: Which of the following amino acids would stick to a CM-sepharose column at pH 7.07 Choose all that…

A: Chromatography is a technique for separation of components of a sample. During chromatography,…

Q: 1. Reduction of thioredoxin 2. Reduction of ribonucleotide reductase 3. Oxidation of thioredoxin…

A: Ribonucleotide reductase is an enzyme that reduces ribonucleotides to deoxy-ribonucleotides. It…

Q: 8. hich of the following is polypeptides? O true about The peptide bond that links the amino acids…

A: A functional protein is built up of polypeptide chains, which are composed of amino acids and folded…

Q: In the laboratory a team of peptide/protein chemists synthesize the HIV-1 protease from all…

A: According to the mirror symmetry, the corresponding D-peptide, as the enantiomer of that specific…

Q: A C AAA|A|AC|C GACC |G| |ATC B Ix D E Y F -methionine lysine phenyl- alanine leucine alanine głycine…

A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…

Q: Protein synthesis in bacterial cells usually starts with a" A. Alanine Residue B. Formylmethionine…

A: Protein synthesis is a 5 step process (Activation of amino acids, Transfer of amino acids to tRNA,…

Q: 14. Draw the structure of a U•A•U base triple. Draw hydrogen bonds as dashed lines, and draw…

A: a pairing of complementary bases in a double-stranded nucleic acid molecule, comprised of a purine…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :- Met-ala-phe-lys-stop DNA…

Q: 7. All are examples of complex carbohydrates, EXCEPT. A. Starch В. Реctin C. Hemicellulose D.…

A: 7. Hemicellulose. Hemicellulose is a heterogeneous polymer composed of many sugars, such as xylose,…

Q: Nucleosides consist of a nitrogenous base bound by an N-glycosyl linkage to a phosphorylated…

A: Asked : Given statement is true or false

Q: 客 **** Antiparallel B sheet Ala side chains Gly side chains **1 Figure 4-14a Lehninger Principles of…

A: Silk proteins are produced and processed as liquid dope inside silk glands of proteinaceous spider…

Q: 1. Doesn't non-fat milk protein contain casein which interacts with the Bradford reagent. why would…

A: Bradford and biuret reagent reacts with protein andg ives a visible colour.

Q: 3. One strategy for designing an antiviral drug against hepatitis C virus (HCV) is targeting on the…

A: Isolation and purification of the viral particles are crucial for research on viruses. Viral…

Q: Which of these characteristics does not describe the B sheet? Amino acid side chains are located…

A: Proteins are polypeptide sequences that are composed of amino acids. Proteins are synthesized by the…

Q: 7. Give the 2 examples of each of the followings:- (a) hydrophilic amino acid, (b) Charged AA, and…

A: Amino acids can be classified depending on the side chain/group it possess. hydrophilic/polar amino…

Q: Penicillin,an antibiotic inhibits the formation of cross links between sugar groups in…

A: Penicillin is a group of antibiotics derived the fungi, penicillium. They are known to be effective…

Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…

A: The sequence are:

Q: To make Cytidine 5'-triphosphate we must ALWAYS first make which nucleotide? O Adenylate O…

A: Nucleic acids are composed of nucleotides. Nucleotides are made up of pentose sugar, nitrogenous…

Q: llowing nucleobases (designated A-D) with their names and answer questions about them. NH NH, B NH D…

A: A canonical base pairing follows Watson–Crick base-pairing method that includes the A base pair with…

Question

37. Peptidoglycan tail is made of sterioisomers of amino acids to minimise helix formation

Group of answer choices

True

False

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

32. The antimetabolites inhibit: a) the ribosome assembly b) the ribosome movement c) cell respiration d) glycolysis e) the Krebs cycle
28) peptidyl transferase enzyme activity forms A- peptide bonds between nucleotides B-peptide bonds between amino acids C- phoshodiester bonds between nucleotides D- hydrogen bonds between nucleic acid bases E- phosphodiester Bonds between amino acids
Pseudopeptidoglycan is a characteristic of the walls of. eukaryotic cells bacterial prokaryotic cells archaean prokaryotic cells bacterial and archaean prokaryotic cells
Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How would this provide an advantage to the bacteria?
A scientist isolates a new species of prokaryote He notes that the specimen is a bacillus with a lipid bilayer and cell wall that stains positive for peptidoglycan. Its circular chromosome replicates from a single origin of replication. Is the specimen most likely an Archaea, a Gram-positive bacterium, or a Gram-negative bacterium? How do you know?
40. In peptidoglycan structure, the 3rd amino acid is connected to 3rd amino acid of the adjacent tetrapeptide tail Group of answer choices True False
it is a dihybridcross
When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base.
Penicillin,an antibiotic inhibits the formation of cross links between sugar groups in peptidoglycan.Bacteria treated with penicillin should be:
a. Why is it important to eat food containing antioxidants? Write at leasttwo reactions to prove the answer. b. Write in four ways the following nucleotide sequence: ATGCA. c. Explain i. Hoogsteen pairing & ii. Hyperchromic effectiii. Epimers Iv. Mutarotaton v. Aldose vi. Anomers vii. Mutarotation
How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a summarized/simple way. And include it in bullet points. Thank you so much
A methyltransferase enzyme capable of methylating ribosomes and changing their structure might protect against (choose all that apply) A. chloramphenicol B. penicillin C. polymyxin B D. bacitracin E. tetracycline