Please make a diagram showing the process of how to make amylase. The diagram can be to the making of any protein, starting with the dna in the nucleus and ending with the exocytosis of the salivary amylase out of the cells in the salivary glands. Please show work and pictures. Thank you.

Please make a diagram showing the process of how to make amylase. The diagram can be to the making of any protein, starting with the dna in the nucleus and ending with the exocytosis of the salivary amylase out of the cells in the salivary glands. Please show work and pictures. Thank you.

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter3: Carbohydrates

Section: Chapter Questions

Problem 7SC

See similar textbooks

Related questions

Q: intermediate is necessary for glycogenesis to occur

A: Glucose-1-phosphate is the intermediate necessary for glycogenesis to occur. Option B is the…

Q: create a flow chart or diagram to illustrate the digestion and absorption of carbohydrates. The…

A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the glycosidic…

Q: [ALPHABETICAL ORDER] Name the first of 13 glucogenic amino acids that convert to an intermediate…

A: Glucogenic aminoacids are those that form an intermediate precursor of glucose which are converted…

Q: High energy condition favors glycolysis, Krebs cycle and b-oxidation of fatty acids. Low energy…

A: A. Neither statements are correct.

Q: enzyme is necessary for the "degredation of peptone

A: Peptone is a decomposition product of protein formed by either partial or complete degradation of…

Q: In glycogen synthesis , the active form of glucose used is :: A) glucose 6 phosphate B) glucose 1…

A: Glycogen Synthesis is the process of synthesis of glycogen from glucose in liver and skeletal…

Q: The acceptable percentage of energy from Omega 3 fatty acids may be:

A: Hello, as your question has many parts, we will only answer the first part for you and if you want…

Q: PLEASE ANSWER THIS. CAN FATTY ACIDS SERVE AS A DIRECT SOURCE OF GLUCOSE? CAN FATTY ACIDS BE…

A: A process which involves a series of chemical reactions that are interconnected and occurs within a…

Q: Why is gluconeogenesis important in the cori cycle? (Please refrain from copying the answers on the…

A: Under normal conditions, cells obtain their energy by the complete oxidation of glucose, and excess…

Q: Name the substrates for the following enzymes: a) trypsinb) amylasec) pepsind) lipase

A: Chemical digestion of nutrients occurs in the digestive system. Several digestive glands and organs…

Q: Which words are associated with requiring energy? Select all that apply O endergonic catabolic…

A: Metabolism is process of various biochemical reactions that breaks and makes the molecules in the…

Q: a For the B vitamins below, indicate which of the following processes each vitamin is involved in as…

A: Introduction Glycolysis : It Is The Metabolic Mechanism That Converts Glucose Into Two Pyruvate…

Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…

A: Sphingophospholipids contain an amino alcohol called sphingosine instead of glycerol, a fatty acid,…

Q: Gluconeogenesis is the process of producing glucose from non-carbohydrate sources. Choose one: False…

A: The body need energy (ATP) to conduct work, and glucose provides this energy. Glucose is taken from…

Q: Can you please pick the right answer in each parentheses? Sphingolipids are synthesized from…

A: Introduction: Sphingolipids are synthesized from "Palmitoyl-CoA" and have a diversity of biological…

Q: [ALPHABETICAL ORDER] Name the twelfth 13 glucogenic amino acids that convert to an intermediate…

A: Glucogenic amino acids are those amino acids that have the capability of converting into glucose by…

Q: Sucrose also known as invert sugar can be enzymatically hydrolyzed by the enzyme amylase to give the…

A: Sucrose is a di-saccharide made up of one glucose and one fructose joined together with…

Q: The following test tubes were set up to measure the effect of temperature and pH on salivary…

A: Every enzyme has works in an optimal range of temperature and pH. Below or above this range, the…

Q: CHOOSE THE CORRECT LETTER 1.Glycogenesis is favored when there is low ATP concentration.…

A: Glycolysis is the process of oxidation of glucose into pyruvate. This results in the production of…

Q: Please explain the requirement for ATP in the overall process of fatty acid biosynthesis. Enter your…

A: ATP is the primary energy storage molecule found in the cell due to the presence of high-energy…

Q: Find the amino acid sequence of insulin through an Internet search, write down the first three amino…

A: Biological macromolecules are the substance which are needed in sufficient amount for body . These…

Q: The enzyme involved in the successive cleavage of one glucose unit from the non-reducing end of…

A: During glycogenolysis, terminal glucose residue removes as alpha-D-glucose-1-phosphate(G1P) from…

Q: By looking into the triacylglycerides synthesis pathway, suggest a possible treatment for fat…

A: Fat is a lipid that is stored in the adipose tissues of the body. It has a role in a range of…

Q: The following link carbohydrate metabolism with lipid biosynthesis: (a) How many molecules of…

Q: [ALPHABETICAL ORDER] Name the eleventh of 13 glucogenic amino acids that convert to an intermediate…

A: Amino acids are classified into two different types based upon their catabolic pathways: Glucogenic…

Q: 1. Arabinose is a pentose and an aldose 2. Glucose-6-phosphate cannot leave cell because its size is…

A: The Arabinose is a type of sugar or saccharide ,it is further classified as monosaccharide . Glucose…

Q: composed of two or more subunits, quaternary structure,

A: The skeletal muscle has light and light color bands which are perpendicular to longitudinal axis by…

Q: Match each item in column A with the most closely related item in column B. Place letters for…

A: Biochemistry refers to the study of all the chemical reactions and metabolic processes associated…

Q: List all enzymes in the digestive tract that catalyzes hydrolysis of carbohydrates, fats, and…

A: Carbohydrates digestion 1. Salivary amylase produced in salivary gland and released in mouth…

Q: Identify the catalyst or coenzyme described by the following statements. Write your answer in the…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…

Q: What is an insulin

A: Insulin is a type of hormone. Hormones are the signalling molecules that are synthesized by glands…

Q: Which carbons of glucose will be incorporated into Palmitic acid by the Fatty acid Synthase?…

A: Fatty acid synthesis takes place when the acetyl CoA is gradually assembled into the growing chain…

Q: All the Bold answers are wrong please explain why it is wrong and give me the correct answer.…

A: Hi! Thanks for your question. But as you have posted multiple questions and have not mentioned which…

Q: Every valentine’s day, CVS sells chocolate-covered cherries. The chocolate-covered cherries are…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: here are a number of substances included in energy drinks mentioned. Sort the components into…

A: Energy drinks are popular beverages among people worldwide which is said to increase physical…

Q: Using the following information, work out the total calorie content: Carbohydrates 30g of which…

A: These macros work into a diet. feeding a good selection and enough of those helps you meet your…

Q: Why is it that this energy carrier is considered to be high energy containing phosphate? Bond of…

A: Thermodynamics of a reaction is very important to understand the relation between heat and work,…

Q: Does aldolase B deficiency affect gluconeogenesis? Explain your answer.

A: Fructose-bisphosphate aldolase B or liver-type aldolase, commonly known as aldolase B, is an…

Q: Based on the lock and key model do enzymes get used up? Provide a reason for your answer

A: Enzyme Enzymes are chemical catalysts which regulate the biochemical reactions. In living organism…

Q: The energy for gluconeogenesis is obtained from

A: The energy for gluconeogenesis is obtained from beta-oxidation of fatty acids, option C.

Q: Please list down the 20 essential amino acids.

Q: An example of a ketotriose seen in glycolysis is ________________________. An example of a…

A: CONCEPT: The enzyme fructose diphosphate aldolase catalyzes the cleavage of fructose…

Q: Which part of the cell does fatty acid biosynthesis take place? List the reactions and enzymes in…

A: Fatty acid synthesis is the process of making fatty acids from acetyl-CoA and NADPH by employing…

Q: How many fresh pig carcasses would you need to produce 3 kg of insulin?

A: 139405.20g fresh pig caresses would you need to produce 3kg of insulin. See the calculation below-

Q: Please kindly mention all vitamins and discuss their role in metabolism pathways?

A: Vitamins are organic compounds that are needed in limited amounts by humans. The majority of…

Q: Which of the following enzymes are involved in phosphorylation process Question 8 options:…

A: Enzymes are biological catalysts that help chemical processes occur faster. Enzymes are proteins…

Q: During glycogen synthesis in vertebrates, _____ is added to the growing chain by glycogen synthase.…

A: Glycogen is considered as a storage material for the animals. This helps in the production of energy…

Q: Describe some general differences between fat-soluble and water-soluble vitamins. no handwritten…

A: Vitamin A, D, E, K are fat soluble vitamins while vitamin B and C are water soluble vitamins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

All the Bold answers are wrong please explain why it is wrong and give me the correct answer. Thanks, in advanced Which of the following is true about enzymes? Enzymes are equally effective across broad ranges of temperature and Ph. Enzymes lower the overall free energy of a reaction to make it spontaneous. Enzyme activity is generally unregulated. Enzymes recognize many substrates with equal specificity. The insulin receptor catalyzes the phosphorylation of several substrates and is therefore classified as a Transferase Phosphate Kinase Lyase Oxidoreductase 3)Which of the following reaction parameters can enzymes optimize to increase reaction rate? The proximity(=closeness) of the reacting groups. The rotational motions of the substrates and catalytic groups. The orientations of the substrates and catalytic groups. The achieve energy needed to achieve the transition state. The catalytic mechanism of RNA relies upon general acid-base catalysis involving the amino acid…
Create a diagram showing the process of how to make Salivary Amylase. the diagram can be generic to the making of any protein, starting with the DNA in the nucleus and ending with the exocytosis of the Salivary Amylase out of the cells in your salivary glands NOT GRADED
Which of the following answer choices correctly describes the function of amylase? Select one: a. Cleaves polysaccharides into glucose, limit dextrins, and maltose b. Cleaves each molecule of glucose into two molecules of pyruvate c. Cleaves monosaccharides into glucose, limit dextrins, and maltose d. Cleaves polysaccharides into amino acids, limit dextrins, and monosaccharides at alpha-1-6 branch points
CHOOSE THE CORRECT LETTER What intermediate is necessary for glycogenesis to occur?A. UDPB. glucose-1-phosphateC. UTPD. UDP-glucose
What is the structure that secretes amylase to aid in the digestion of starches?? Any help, please
Write a note on fat soluble vitamins .
If extracellular levels of carbohydrate are high, this molecule triggers the import of monosaccharide into the cell, Group of answer choices Insulin Glucagon cAMP Adrenalin multiple of the answers can be correct please help!
Proteasas are enzymes that break down proteins. Gastric proteasas are found in the stomach; intestinal proteases are found in the small intestine. Estimate the optimum pH for these two enzymes and identify as acidic or basic: Gastric proteases: pH= ____; acidic or basic Intestinal proteases activity: pH= ____; acidic or basic
In a table format differentiate the water-soluble vitamins and fat-soluble vitamins
Which of the following foods can someone who has lactoseintolerance eat?(a) ice cream(b) french fries(c) a chocolate milkshake
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?
Please state if the statements are true or false.1. Arabinose is a pentose and an aldose2. Glucose-6-phosphate cannot leave cell because its size is too large to pass through the pores of the cell membrane