pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the BamHI/EcoRI double digest produces only 3 fragments what are their sizes, why is this so? There are two 3 kb fragments There are two 6 kb fragments There are two of the same size fragments, but we don't know which. We cannot determine this from the information given.

pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the BamHI/EcoRI double digest produces only 3 fragments what are their sizes, why is this so? There are two 3 kb fragments There are two 6 kb fragments There are two of the same size fragments, but we don't know which. We cannot determine this from the information given.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the double digest produces 4 fragments, with only 3 sizes what is the largest fragment size? 3.0kb 4.0kb 2.0kb 8.0kb
pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb What is the largest fragment size that the BamHI/EcoRI double digest produces? 2.250 kb 2.500 kb 2kb 8 kb
pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb How many times does the enzyme NcoI cut? 1 2 We don't know from the information given. 0
A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes were obtained from this reaction: BamHI: 20-kb, 6-kb, and 4-kb fragments HpaII: 21-kb and 9-kb fragments BamHI and HpaII: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sites.
Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′
If pET32a(+) is digested simultaneously with BamHI and BclI, 1.How many fragments are created? 2. What is the size of each fragment? 3. Write down the base pairs that result at the 5’ and 3’ ends of the shortest fragment.
A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.
If pET32a(+) is digested simultaneously with BamHI and BclI,5.1. How many fragments are created?5.2. What is the size of each fragment?5.3. Write down the base pairs that result at the 5’ and 3’ ends of the shortest fragment.
A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes are obtained from these reactions: BamHI: 20-kb, 6-kb, and 4-kb fragments HpaII: 21-kb and 9-kb fragments BamHI and HpaII: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sites.
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

		There are two 3 kb fragments
		There are two 6 kb fragments
		There are two of the same size fragments, but we don't know which.
		We cannot determine this from the information given.