Prokaryotes use methylation as a major mechanism of DNA protection because (A) methyl groups include bonds that are impossible to break (B) methyl groups physically block portions of DNA that enzymes would otherwise access to breakdown DNA (C) methyl groups are added to DNA by restriction enzymes in the cytoplasm (D) methyl groups prevent spontaneous breakdown of DNA that otherwise would occur in the cytoplasm

Prokaryotes use methylation as a major mechanism of DNA protection because (A) methyl groups include bonds that are impossible to break (B) methyl groups physically block portions of DNA that enzymes would otherwise access to breakdown DNA (C) methyl groups are added to DNA by restriction enzymes in the cytoplasm (D) methyl groups prevent spontaneous breakdown of DNA that otherwise would occur in the cytoplasm

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

DNA repair enzymes preferentially repair mis- matched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were instead repaired without regard for which strand served as template, would mismatch repair reduce repli- cation errors? Would such a mismatch repair system result in fewer mutations, more mutations, or the same number of mutations as there would have been without any repair at all? Explain your answers.
What are some of the ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors? Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?
DNA repair processes use the old DNA strand as the template to repair mismatched bases on the newly synthesized strand . A yeast strain (yst150) has a mutation on the gene coding for the enzyme responsible for distinguishing between the old and new strand of DNA . How does the mutation rate of strain yst150 compare with the rate of non-mutant (wild-type ) yeast ? Explain your answer .
What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA strand? How does the use of this template result in a telomere sequence that is tandemly repetitive?
Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each strand. Sticky ends are useful in making recombinant DNA because Select one: a. Sticky ends contain the exact same nucleotides that allows fragments to splice together. b. Sticky ends contain nucleotides with complementary bases that allows fragments to splice together. c. Sticky ends contain the exact same nucleotides that can form hydrogen bonds. d. Sticky ends contain nucleotides with complementary bases that can form hydrogen bonds.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
If Avery, MacLeod, and McCarty had found that samples of heat-killed bacteria treated with RNase and DNase transformed bacteria, but that samples treated with protease did not, what conclusion would they have drawn? a. Protease carries out transformation. b. RNA and DNA are the genetic materials. c. Protein is the genetic material. d. RNase and DNAse are necessary for transformation
Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA?
a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.
How do we know that DNA also serves as the genetic material in eukaryotes such as humans?
All of the following statements about telomerase are correct except: A. the RNA component acts as a template for the synthesis of a segment of DNA. B. it adds telomeric repeats to the 5'-ends of the DNA strands. C. it provides a mechanism for replicating the ends of linear chromosomes. D. it recognizes a G-rich single strand of DNA E. it is a reverse transcripcase.