You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast?

You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Briefly explain your answer.

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication. Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
Suppose that replication is initiated in a medium containing moderately radioactive tritiated thymine. After a few minutes of incubation, the bacteria are transferred to a medium containing highly radioactive tritiated thymidine. Sketch the autoradiographic pattern that would be seen for (a) undirectional replication and (b) bidirectional replication, each from a single origin.
When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
You decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication?
In eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication of a chromosome of 150 million base pairs take if eukaryotic chromosomes were replicated like those of prokaryotes? Actually, eukaryotic replication takes only several hours. How do eukaryotes achieve this high rate?
You decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication? Multiple Choice One band of intermediate density. One band of light density. One band of heavy density. One band of light density and one band of heavy density. One band of light density and one band of intermediate density.
The Meselson-Stahl experiment provided strong evidence that DNA replication was conservative, by alternately growing bacteria in medium with heavy 15N and light 14N. If DNA replication were dispersive, what result would Meselson and Stahl have observed after the first round of DNA replication in light nitrogen? Group of answer choices Two bands, one at the location for pure 15N and one at the location for pure 14N. One band, located half way between the locations for pure 15N and pure 14N. Two bands, one at the location for pure 15N and one located halfway between the locations for pure 15N and pure 14N. None of these Three bands, one at the location for pure 15N, one at the location for pure 14N, and one at a location halfway between.
Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?
Human Fbh1 helicase is important in the process of DNA replication. When a mutation occurs during the production of Fbh1, the result is a mutant Fbh1 that binds at the replication fork and prevents any helicase protein from attaching to the strand. Based on this information and the image shown, what would happen during DNA replication if this mutant helicase were present? A - Topoisomerase would unwind the DNA and an RNA primer would attach to the DNA molecule and initiate replication. The process would then stop at the blue triangle because helicase is needed to separate the strands of DNA. B - Topoisomerase would unwind the DNA, but then the process would stop at the blue triangle because helicase, the RNA primer, would not be able to attach to the DNA molecule and initiate replication. C - The process would begin at the blue triangle when topoisomerase unwinds the DNA and an RNA primer attaches to the DNA molecule and initiates replication. DNA polymerase would begin the synthesis…
DNA repair processes use the old DNA strand as the template to repair mismatched bases on the newly synthesized strand . A yeast strain (yst150) has a mutation on the gene coding for the enzyme responsible for distinguishing between the old and new strand of DNA . How does the mutation rate of strain yst150 compare with the rate of non-mutant (wild-type ) yeast ? Explain your answer .
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Consider a DNA molecule with the following structure a. if during replication , the T at position 4 is read as an A resulting in a misincorporation in the new DNA strand . If the misincorporation is not repair , draw or write the results of the second round of replication b. After the second round of replication , what specific type of point mutation is now permanent in the DNA sequence ? c. List the two cellular mechanisms that failed to prevent the establishment of this permanent mutation .