Q: What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool…
A: NCBI is the database that stores the information regarding the gene sequences and protein sequences.…
Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that…
A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide…
Q: 1000bg 800b 500bd 300bd 100bg Identify the sizes of the DNA bands in the agarose gel above using the…
A: Agarose gel electrophoresis is a separation technique mostly used for DNA molecules. Where a sample…
Q: 1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA, based…
A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…
Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…
A: Here we provide you the Number of contigs formed from given sequences and the sequence of exon 3…
Q: When proteins are separated using native gel electrophoresis, size, shape, and charge control their…
A: Gel electrophoresis is a method for separation and analysis of macromolecules like DNA, RNA, and…
Q: How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is…
A: Note-We are supposed to answer only 1 question as per Bartleby guidelines. Kindly, repost the other…
Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…
A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…
Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…
A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…
Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was…
A: Ion Torrent sequencing is also known by the name of: Ion semiconductor sequencing pH-mediated…
Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…
A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…
Q: what type of gel(in terms of material) can be more suitable for the electrophoresis of 500-1000bp…
A: DNA tests are stacked into spaces toward one side of a gel, and an electric current is applied to…
Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5' If the given DNA sample was…
A: Ion torrent sequencing : The ion torrent sequencing techniques makes use of the principle that when…
Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…
A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…
Q: what kinds of techniques are used to sequence large fragments of dna upto 50kb
A: With the advancement of science and technology in the field of life sciences, there has emerged…
Q: oner micro mole of 48 nulceotide dna was synthesised via solid phase .this sample contains salts…
A: DNA (deoxyribonucleic acid) is the polymer of nucleotides joined by a phosphodiester linkage. Each…
Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…
A: This sequencing is a laboratory technique used for the determining of DNA sequence of an organism's…
Q: For human genomic DNA what is the expected fragment size for high molecular weight DNA extracts?…
A: Gel electrophoresis is a technique used for the separation of proteins or nucleic acids based on…
Q: Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein…
A: The Smith-Waterman algorithm uses local sequence alignment to find similar regions between two…
Q: Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: Can you please help with 1b please. picture with 1 graph is for question 1a) picture with 4 graphs…
A: Denaturation refers to the breaking of the double-stranded DNA into single strands. It is carried…
Q: Calculate the concentration of DNA in your purified sample and determine the mass of the purified…
A: More details are needed to determine the mass of purified DNA. So here we providing you the…
Q: Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs…
A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…
Q: Method on the following 5 sequences and find the best multiple sequence alignments. Sequence # 1:…
A: Progressive alignment is a heuristic for multiple sequence alignment that does not optimize any…
Q: if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment…
A: Aligning one or more sequences by introducing gaps is termed as gap penalty method. The introduction…
Q: If you were to isolate genomic DNA from two people and perform restriction enzyme digestion followed…
A: Agarose gel electrophoresis is a technique for distinguishing DNA bands based on size. To…
Q: What are some difficulties with low copy number DNA analysis? What kinds of checks and balances can…
A: INTRODUCTION DNA analysis DNA analysis is a method of analyzing the characteristics of DNA. It is…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?
A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…
Q: Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is…
A: Step 1 Sequencing is the establishment of the primary structure of an unbranched polymer. Sequencing…
Q: 1c) What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA,…
A: Deoxyribonucleic acidi an atom made out of two polynucleotide chains that curl around one another to…
Q: A batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by…
A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…
Q: Discuss the main similarities and differences in the nucleic acid sequencing methods known as…
A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…
Q: Discuss the use of gel electrophoresis for the separation of macromolecules (DNA, RNA and protein)…
A: In biotechnology the gel electrophoresis is routinely used technique that is used for the separation…
Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…
A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…
Q: Southern and Northern blotting are powerful molecular biological tools based on hybridization of…
A: There are basically 4 types of blotting: Southern blotting. Western blotting. Northern blotting.…
Q: Consider the four extraction/purification methods . a. Which extraction method would you use for a…
A: DNA isolated from various biological samples can be used for a vast array of downstream…
Q: DNA bands from each sample lane of the gel electropherogram below.
A: Key points: Gel electrophoresis is a technique used to separate DNA fragments according to their…
Q: write down the applications of pair wise and multipal sequence alignment in the field of…
A: Multiple sequence alignment or MSA of nucleic acids i.e. DNA, RNA and proteins is nowadays one of…
Q: Southern blotting is a method used in molecular biology for detection of a specific DNA sequence in…
A: Nucleic acid blotting is a well-established technique for locating a gene or sequence of interest…
Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…
A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…
A: The Sanger sequencing method is also called as chain termination method. In this method, dideoxy…
Q: How are the gap penalties adjusted in the ClustalW multiple sequence alignment program to improve…
A: The method used to score the alignment of two or more than two sequences is known as the gap…
Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…
A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…
Q: What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA)…
A: Multiple sequence alignment (MSA) is the process or outcome of aligning three or more biological…
Q: If I take random biological sequences from a data bank, I see even more sequence similarity. Why ?
A: BLAST stands for the Basic local alignment search tool. It is available through the web portal of…
3b)Protein sequences are usually more advantageous than DNA sequence in the comparative pairwise alignment analysis. Elaborate this statement.
Step by step
Solved in 2 steps
- Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATTconsider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
- What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHYou wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.
- Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment using gaps?S1: ACGTCATCA S2: TAGTGTCA How many global alignments generate the same maximum score?
- Use the data in the table below and the gel picture to create a graph (using the graphic paper below) and determine the size of fragments created by EcoRI and BamHI. Agarose Gel Electrophoresis of λ DNA treated with HindIII, EcoRI, and BamHI HindIII EcoRI BamHI Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) 23455 11985 7430 4375 2150 1850Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite and minisatel lite DNA. How is this repetitious DNA useful for identifying individuals by the technique of DNA fingerprinting?You have a very concentrated sample of DNA which you need to dilute for sequencing 1:6000 with a final volume of 10 μl. How would you do this in four steps, using a serial dilution? Do not pipet less than 1 ul and do not make more than 10 ul per dilution. Describe how to do each dilution using the format suggested below.