Q: Define electrophoresis. What are the different types of electrophoresis ?

Q: Discuss the possible results of failing to document data?

A: Data documentation is an important and vital part of the healthcare industry as the data of the…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: which factors influence the choice of bioreactor design?

A: Bioreactor is the biochemical designed mechanical vessel wherein biochemical transformation happen…

Q: What is a stem cell?

A: The fertilization of sperm and ovum results in a zygote which is diploid in nature. The zygote…

Q: How to prepare chromosomes for SEM Imaging?

A: The electron microscope which scans the surface of a sample by focussed beam of electrons to produce…

Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…

Q: Explain what is meant by IMViC.

A: IMViC is an acronym that stands for four different diagnostic tests for the identification of…

Q: How you apply your knowledge on tissue culture in biotechnology?

A: The science of growing of plants, tissues or organs from the mother plant under the in-vitro…

Q: Discuss an example of ex vivo and of in vivo genetherapy.

A: Gene therapy is the science that deals with the insertion of a gene into the defective cells having…

Q: Suppose you carry out genomic, transcriptomic, and proteomicstudies on a single tissue. What type of…

A: Omics is the informal branch of biology that includes disciplines like transcriptomics,…

Q: 1. Do you think nanotechnology poses health risk? Justify your answer by citing references.

A: Nanotechnology: It is the branch of science which deals with atoms and molecules at nanoscale…

Q: State and describe the benefits of using whole-genome sequencing for diagnosis.

A: The whole genome shotgun method involves cloning, followed by accurate computer sequencing of the…

Q: Explain ORF analysis.

A: Protein translocation is a process where proteins move between cellular components. It can occur…

Q: Describe the PET technique?

A: Any abnormal condition that hinders normal body functioning is considered a disease. Microbial…

Q: Differntiate between cytotaxonomy and chemotaxonomy?

A: Scientific classification is the study of naming, depicting, and grouping creatures and incorporates…

Q: Decide whether each of these statements is true or false, and then explain why. Laser-capture…

A: Different techniques are available to visualise a single cell from a given tissue.

Q: Define the term electrophoresis.

A: Proteins are large, complex molecules that perform a wide range of functions in the human body.…

Q: What is the purpose of Aseptic technique?

A: The living environment is always surrounded by various microbes, the room temperature paves the…

Q: topic: cheek cells 1. why are stains such as methylene blue used when observing cells under the…

A: Methylene blue helps to stain the animal's cells especially nuclei to make it more visible in the…

Q: What is microsleep?

A: Sleep is a state our body requires to rejuvenate and to do the regular activities normally. It is a…

Q: State the function of power supply, DNA marker, and ethidium bromide used in the electrophoresis…

A:

Q: What is SDS PAGE?

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: Define STR and its application

A: Since you have posted multiple questions, we will solve the first question for you. If you want any…

Q: Explain about Genomic techniques ?

A: Introduction  Genome is basically consisting of DNA which is composed of deoxyribose nucleotides.…

Q: Discuss the principles that govern the presence and maintenance of stem cells both in vivo and in…

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Elaborate on DNA capabilities

A: DNA or deoxyribonucleic acid is a macromolecule composed of two polynucleotide chains that coil…

Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…

A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…

Q: How can genetic testing help in cancer diagnosis? Briefly explain

A: Cancer is a group of disease which involves abnormal growth of cell with the ability to spread to…

Q: ) Give an example of Class III Biomedical device? Discuss why it is classified as Class III?

A: To determine: Why some devices are classified under class 3. Some examples of it.

Q: Go Green Before the Green Goes by Nano What does it mean? Please elaborate.

A: It is critical to protect the environment so as to reduce the destruction of eco-systems caused by…

Q: What is the use of fMRI?

A: fMRI is the abbreviation for Functional Magnetic Resonance Imaging which is a non-invasive test used…

Q: Find/cite specific example and give a minor/slight description for the given applications of…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: What are some of the drugs used to study microfilaments?

A: The cytoskeleton has three different types of protein elements. From narrowest to widest, they are…

Q: How are stem cells harvested?

A: Stem cells:These are cells that are capable of differentiation and self-renewal.Stem cells have the…

Q: outline the five main steps used to make a karyotpe?

A: Karyotype is a simple picture of a person's chromosomes. In order to get this picture, a person's…

Q: What are imaging biomarkers?

A: A biomarker is a biological characteristic that is measured and evaluated as an indicator of a…

Q: How is DNA microarray used in detecting cancer?

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Describe the outcome of Yanofsky TrpR experiments?

A: Introduction  Charles Yanofsky was an American Geneticist which work on regulation of messenger RNA…

Q: Describe the use of stem cells in medicine and cosmetology, analyze the advantages and disadvantages…

A: The use of stem cells to treat or prevent a disease or condition is known as stem-cell therapy.…

Q: Discuss the steps of the research process ?

A: Epidemiologists are public health workers. They investigate each and every statistical pattern and…

Q: Compare the accuracy of DNA replication, RNA synthesis, and protein synthesis. Which mechanisms are…

A: The fidelity rate depends upon the rate of accuracy of the metabolic processes such as DNA…

Q: Define about Pharmacogenomics ?

A: The whole collection of DNA in an organism is known as its genome. The human genome is made up of…

Q: Define centrifugation and aliquoting.

A: Centrifuge is a device that is used for the separation of different components of a fluid with the…

Q: elp ASAP, thank you! (question is asking to pick Which 6 features are shown in the figure?)

A: The reaction given in the figure shows the enzyme catalyzed reaction with the formation and breakage…

Q: Discuss the uses of stem cells.

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: -hat is the 6 main basic procedure of enetic engineering?

A: Genetic engineering is the process in which the gene of interest is altered by using Recombinant DNA…