Q1. Using a data structure helps in writing an efficient algorithm. * O True False
Q: 1. What does “portable" means in the context of computer programming? 2. What is Java virtual…
A: "Portable" in programming language means that the application or the program has an ability to run…
Q: ost recent digital wireless comm
A: Below the influence of the most recent digital wireless communication technologies on the…
Q: 3. Write an Octave program to a. Read a complex number from the user b. Display its magnitude and…
A: Answer : Program :
Q: In this c language program. Please fixed the date and show the output of the program. Source Code:…
A: Please refer below code and output: Below is the corrected code I have made changes on line 18 and…
Q: Determine three unique smartphone applications that would be extremely useful in your present or…
A: Numerous smartphone apps are available nowadays that help you be more productive at work. You can do…
Q: Q30. Every node in the tree has a parent except . External Node Siblings Node Root Node Internal…
A: let's see the correct answer of the question
Q: Given the code segment below, what should be the data type of the formal parameter in the function…
A: void func( ______ );intmain(){ double aData[6][4];func(&aData[4][1]);return 0;}
Q: Recognize and categorize the data on your computer or personal digital assistant. What information…
A: Confidential:- Confidential information should not be shared with anyone outside the personal space.…
Q: Describe the many types of system architectures available.
A: The system architecture analysis and design that can be usually get concerned and owned by the main…
Q: The majority of appliances are now wirelessly enabled as a result of technological advancements. Is…
A: Introduction: In residential, commercial, and industrial settings, wireless technologies and devices…
Q: Does the phrase "Cache staleness and high MAC overhead combined result in a considerable reduction…
A: Introduction: DSR is an acronym for Department of State Regulation (Dynamic Source Routing)The DSR…
Q: distinguish between pipeline processing and parallel processing
A: Start: Pipelining executes independent computations in an interleaved fashion, whereas parallel…
Q: What is the difference between computer literacy and information literacy, and how do you explain…
A: Explanation: Computer literacy is concerned with the ability to utilise computer programmes rather…
Q: When using HTTP streaming, are the TCP receive buffer and the client's application buffer the same…
A: The Answer for the given question is in step-2.
Q: What are the basic components of an automated System and their functions ?
A: Here we need to tell the basic components of an automated system and their functions.
Q: Explain why change is unavoidable in complex systems, and provide examples of software process…
A: Reasons, why change is unavoidable in a complex system, include the following: Modifications to the…
Q: With specific examples, distinguish between the RISC and CISC architectures and instruction sets.
A: Explanation: The RISC ISA places a greater emphasis on software than on hardware. The RISC…
Q: After doing the following statement, the linked list becomes Head.Link = P Head 3000 4800 null 10…
A: Head.Link=P means p links to the head link and head links point to the 4800 address of the packet…
Q: Trace the output the programming below. { int num[]; int size =5; num = new int [size]; num…
A: int size =5; Assign size with 5 num = new int [size]; Declare an array of size 5. The index of…
Q: Define the following: 1. Web page. 2. Buses. 3. Motherboard.
A: A single hypertext document available on the World Wide Web-(WWW) is a web page. It is made up of…
Q: Recognize and categorize the data on your computer or personal digital assistant. What information…
A: The many types of data stored on a personal computer The data categorization methodology classifies…
Q: What are the most significant technical and nontechnical factors that prevent software reuse? Do you…
A: Problems with Reuse : Maintenance costs have risen. If a reused software system or component's…
Q: In your own words, describe the situation. Personal data privacy is protected under Islamic law
A: Islamic ideas respect personal data privacy. In every industry, the privacy of specific user data is…
Q: What is the most important goal of normalization? What part do determinants play in the process of…
A: The process of Normalization: The act of structuring data in a database is known as normalization.…
Q: A supply chain is performing an end of year inventory of printers in a computer store that asks you…
A: Answer
Q: In what ways does troubleshooting make security breaches and data loss more likely?
A: Security breach: Any incident that leads in unauthorized access to computer data, applications,…
Q: Explain why change is unavoidable in complex systems and provide examples of software process…
A: Reasons why change is unavoidable in a complex system include the following: Modifications to…
Q: A "memory hole" is something that happens in your computer's memory. And how does the operating…
A: Computer memory is a collection of data stored in binary format. The phrase "main memory" refers to…
Q: I have a c++ program where I want to add movies to an existing textfile and show all the movies with…
A: Solution: C++ Program: #include <iostream> #include <fstream> #include <string>…
Q: Discuss CSMA/CA/CD. Describe each one's function and intended network. Describing the benefits and…
A: CSMA -(Carrier Sense Multiple Access) is a method of managing communication when more than one user…
Q: Why security architecture is needed for a firm’s security solution? Outline what is a typical firm’s…
A: Why security architecture is needed for a firm’s security solution? Outline what is a typical firm’s…
Q: Discuss in detail the importance of architectural design in software development.
A: importance of architectural design in software development. Architectural design in software…
Q: Given the code segment below, what should be the data type of the formal parameter in the function…
A: void func( ______ );intmain(){ double aData[6][4];func(aData[6]);return 0;} Answer:- function…
Q: Explain what a challenge–response system is and how it works in the context of authentication. It's…
A: System of provocation–response Password-based authentication is often used in client-server systems.…
Q: The word "artificial intelligence" can refer to a number of different things. Describe the relevance…
A: Overview: Artificial intelligence (AI), in contrast to natural intelligence (NI), is the…
Q: A motorcy tion. The PASCAL km
A: Ac. to given: Let us take 3 variables, m for milage= 48 c for cost of petrol per liter= 20.30 d for…
Q: Why would a 1000Mb CAT6e cable be a terrible choice for a 328-foot length pull for high data…
A: Introduction: "Cat6e" is an abbreviation for "cat6 enhancement." Cat6e cable has the property of…
Q: Describing the benefits and drawback
A: Lets first discuss about CSMA:- PROTOCOL OF THE CSMA Carrier Sense Multiple Access Protocol The…
Q: As a security expert, you are asked to produce a corporate policy statement to protect the IT…
A: Security is the crucial part of the every organisation, because organization can hold the different…
Q: Which concerns were anticipated to be rectified as a result of the first Internet research? Finally,…
A: institution: With various resources, the Internet has developed in a number of ways. It has a…
Q: Suppose that Organization l's network has the IP address 111.0.0.0, Organization 2's network has the…
A: a) i) The IP address is 111.0.0.0 class : A Default subnet mask is : 255.0.0.0 Network IP address :…
Q: There are several purposes for data warehouses.
A: Data warehouse: Information from many sources is collected and monitored by a Data Warehousing (DW)…
Q: side a = 2mn side b = m2-n2 side c = m2+n2 Your program should next use in-line assembler (the…
A: #include<iostream> #include<stdlib.h> #include<iomanip>…
Q: Python Create a program in python whereas: Given a list ot X objects, u want to perform:…
A: I give the code in Python along with the output and code screenshot
Q: What exactly is information privacy? Describe five different ways to keep your personal information…
A: answer is
Q: Why does anonymity matter on the deep web?
A: The Deep Web part of the Internet will fill later on, as individuals attempt to evade stricter…
Q: The objective of Electronic Data Interchange in a fictional supply chain. Three instances of…
A: NOTE :- Below i explain the answer in my own words by which you understand it well. Electronic…
Q: Include the upload a file or picture of your truth table, simplified equation, and logical diagram.…
A: The answer is as follows.
Q: A customer is complaining about slow performance while writing to his windows share running on a…
A: This is to understand how we can softly communicate problem at customers end.
Q: social engineering hacker
A: With regards to information security, social engineering is the mental control of individuals into…
Step by step
Solved in 2 steps
- C++ Given code #include <vector>#include <iostream>#include <algorithm> using namespace std; // The puzzle will always have exactly 20 columnsconst int numCols = 20; // Searches the entire puzzle, but may use helper functions to implement logicvoid searchPuzzle(const char puzzle[][numCols], const string wordBank[], vector <string> &discovered, int numRows, int numWords); // Printer function that outputs a vectorvoid printVector(const vector <string> &v);// Example of one potential helper function.// bool searchPuzzleToTheRight(const char puzzle[][numCols], const string &word, // int rowStart, int colStart) int main(){int numRows, numWords; // grab the array row dimension and amount of wordscin >> numRows >> numWords;// declare a 2D arraychar puzzle[numRows][numCols];// TODO: fill the 2D array via input// read the puzzle in from the input file using cin // create a 1D array for wodsstring wordBank[numWords];// TODO: fill the wordBank…C++ Don't want copy paste answer Overload the ~ operator to return the reversed elements of a String: Object's Value Operator Call Resulting Object's Value "bob" ~obj "bob" "wuz" ~obj "zuw"Please explain all subparts. I will really upvote. Thanks
- Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACTinitial c++ file/starter code: #include <vector>#include <iostream>#include <algorithm> using namespace std; // The puzzle will always have exactly 20 columnsconst int numCols = 20; // Searches the entire puzzle, but may use helper functions to implement logicvoid searchPuzzle(const char puzzle[][numCols], const string wordBank[],vector <string> &discovered, int numRows, int numWords); // Printer function that outputs a vectorvoid printVector(const vector <string> &v);// Example of one potential helper function.// bool searchPuzzleToTheRight(const char puzzle[][numCols], const string &word,// int rowStart, int colStart) int main(){int numRows, numWords; // grab the array row dimension and amount of wordscin >> numRows >> numWords;// declare a 2D arraychar puzzle[numRows][numCols];// TODO: fill the 2D array via input// read the puzzle in from the input file using cin // create a 1D array for wodsstring wordBank[numWords];// TODO:…cout<<"Team name is is "< cout<<"The team got "<<no for (int i=0;i<no_of_medal cout<<medals[i]<< cout<<endl; Sport_team::~Sport_team() { delete []medals; cout<<"Memory free"<<endl } void f(Sport_team o) { cout<<"Team info print by o.print(); } void main() { Sport_team s; string n; int m; cout<<"Enter the sport's cin >>n ; cout<<"Enter number of me cin>>m; . set(n, m) ; s.print(); f(s) ; s.print();
- Please help me with this using java. Create a selection sort java code Please also comment the codeDetail code only else downvoted. section grouping is a string containing just characters "(" and ")". A standard section succession is a section arrangement that can be changed into a right math articulation by embedding characters "1" and "+" between the first characters of the grouping. For instance, section successions "()()" and "(())" are standard (the subsequent articulations are: "(1)+(1)" and "((1+1)+1)"), and ")(", "(" and ")" are not. You are given an integer n. You will likely develop and print precisely n diverse customary section arrangements of length 2n. Input :The primary line contains one integer t (1≤t≤50) — the number of experiments. Each experiment comprises of one line containing one integer n (1≤n≤50). Output :For each experiment, print n lines, each containing an ordinary section grouping of length precisely 2n. All section groupings you output for a testcase ought to appear as something else (however they might rehash in various experiments). In case there…Explain Structures and how this code works: - Imagine you're teaching the material to someone who don't know how or what this code is #include <iostream>#include <iomanip>#include <string>#include <vector>#include <cmath> using namespace std; struct PlayerRec{ string first_name = ""; //First Name string last_name = " "; //Last Name int game = 0; // number of games played float points = 0.0; // points per game of the player}; int main(){ float avgppg = 0; cout << "The Basketball Player List Program\n\n"; cout << "Enter a Player Record \n\n"; // Get vector of PlayerRec objects vector<PlayerRec> player_list; char another = 'y'; while (tolower(another) == 'y') { PlayerRec PlayerRec; // make temporary new (initialized) PlayerRec object cout << "First Name: "; getline(cin, PlayerRec.first_name); cout << "Last name: "; getline(cin,…
- Alphabetic Telephone Number TranslatorMany companies use telephone numbers like 555-GET-FOOD so the number is easier for theircustomers to remember. On a standard telephone, the alphabetic letters are mapped to numbers519in the following fashion:A, B, and C = 2D, E, and F = 3G, H, and I = 4J, K, and L = 5M, N, and O = 6P, Q, R, and S = 7T, U, and V = 8W, X, Y, and Z = 9Write a program that asks the user to enter a 10-character telephone number in the format XXXXXX-XXXX. The application should display the telephone number with any alphabeticcharacters that appeared in the original translated to their numeric equivalent. For example, ifthe user enters 555-GET-FOOD, the application should display 555-438-3663 For the attached assignment, write a python program, you also need to write: Comments for all the values, constants, and functions IPO Variables Pseudcode#include<bits/stdc++.h> #include <cstdio> using namespace std; // A function for genrating random number between range [N,M) double rand_gen(double M, double N) { return M + (rand() / ( RAND_MAX / (N-M) ) ) ; } int main() { cout<<"Enter the radius of circle => "; double r; cin>>r; cout<<"\nEnter the number of points => "; int n; cin>>n; int inside_cn=0; // count of inside points for(int i=1;i<=n;i++) { double x,y; x=rand_gen(0,2*r+1); y=rand_gen(0,2*r+1); double dist_left,dist_right; dist_left=x*x+(y-r)*(y-r); // distance^2 from left semicircle dist_right=(x-2*r)*(x-2*r)+(y-r)*(y-r); // distance^2 from right semicircle if(dist_left<=r*r || dist_right<=r*r) // checking inside condition { cout << fixed;// setting precision for flaoting numbers cout<<"Point No. "<<i<<" (x=…coding in C++ Tic Tac Toe game that will match a player against the computer. Do's: Use a typical 3 x 3 board. The horizontal axis should be labeled A, B, C. The vertical axis should be labeled 1, 2, 3. The horizontal axis (ROWS) should be labeled A, B, C. The vertical axis (COLUMNS)should be labeled 1, 2, 3. Use User-Defined Functions. Use Branching. Use Loops. Use String functions. Randomly determine who will move first, the human or computer. Assign O to the computer and X to the Human player. Ask the user to select their move using the horizontal and vertical position. For example: A1 for the upper left square, or B2 for the center square. After each move, redraw the board with the X's and O's in the right positions. After each game, ask the user if they want to play again. If they do, start the game again. Do not's: Don't use User Classes or Objects Don't use images