Q4) calculate the percentage value the grade of student in mathematic department, then Write a script and draw a pie graph of the percentage, the graph should explode excellent sections at the following table. A mid good 20 Very good 12 excellent pass 56 30
Q: Anvered Write a progran Anvered: Write a progran Answered: The results from Blendeo Assessment my…
A: Algorithm: Start Read member id, sales month and sales amount Define a method RateCommission which…
Q: C++ Please fix some problems with my Tic Tac Toe Program: a. It should declare the winner. Like…
A: Basically, a TIC TAC TOE game is designed which is played by two users. Users keep entering the…
Q: Archery Scorer. Write a program that draws an archery target (see Pro-gramming Exercise 2 from…
A: below is the python code:
Q: Draw a flow chart of perfect number.
A: EXPLANATION - PERFECT NUMBERS - The perfect numbers are those non negative numbers which have the…
Q: Nested-if structure Book Club Memberships Yes No Non Student 300 200 Student 60 50 Write a…
A: A required program is as follows, #include <iostream> using namespace std; int main() {…
Q: F Manhattan distance is an alternative way to define a distance between two points.
A: Answer: Manhattan distance is an alternative way to define a distance between two points. The…
Q: Primary U.S. interstate highways are numbered 1-99. Odd numbers (like the 5 or 95) go north/south,…
A: A required Java program is as follows, File name: “LabProgram.java” import java.util.Scanner; public…
Q: ) World population growtheach year for the next 25 years, using the supposition that the current…
A: for(int i = 1;i<=25;i++) { cp += (cp*rate); printf("%-5d\t%-30ld\t%-20ld\t\n",…
Q: Rent A Van wants a program that calculates the total cost of renting a van. Customers pay a base fee…
A: Answer is given below .
Q: (Factorials) The factorial function is used frequently in probability problems. The factorialof a…
A: Since no programming language is mentioned, I am using c++. Code: #include <iostream>using…
Q: Lecture Activity 4.3: Flowcharting (Selection Structure) Given is GROSS_PAY. Draw a flowchart that…
A: Please upvote/like. I am providing you the correct answer below.
Q: teachers(tea) in the college and calculate and display the students to teachers in the…
A: C used to answer this question
Q: An employee in a company gets special allowance based on employee category. Input his basic salary…
A: PROGRAM CODE: #include <iostream> // include header file for input output stream using…
Q: "### Exercise 1 ###\n", "\n", "The table presented below gives a final grade based on the amount of…
A: Input number of points received from the user. Check if points less than 500, then set grade as 0.…
Q: 4.19 (Sales Commission Calculator) A large company pays its salespeople on a commission basis. The…
A: A large company pays its salespeople on a commission basis. The salespeople receive $200 per week…
Q: Comm Target Outcome: (CO2) Write algorithms to solve different programming problems using flowchart…
A: Here we make simple flow chart:===================================================================
Q: "### Exercise 1 ###\n", "\n", "The table presented below gives a final grade based on the amount of…
A: Algorithm: Algorithm for given problem is: Start print("Enter total points at end of the course:")…
Q: ython A year in the modern Gregorian Calendar consists of 365 days. In reality, the earth takes…
A: return year % 4 == 0 and (year % 100 != 0 or year % 400 == 0)
Q: V. Problem Solving Write the whole formula of the cells based on the data below in the item number…
A: The given problem is related to Excel formulas where the requirement is to complete the provided…
Q: 7) Solving quadratic equation program Let's consider the general formula of a quadratic equation :…
A: Required: Python program to solve the quadric equation. Required code with comments for…
Q: The steps required to construct an ADT. Please complete the following sentences with your answer.
A: Introduction: The ADT merely outlines which procedures must be carried out; it makes no mention of…
Q: 6. Write a program to calculate Cumulative Grade Point Average (CGPA). The program reads student…
A: The given program is below with commented code and output which contains all three functions and a…
Q: the country, and its annual death rate. The program should then calculate the expected population…
A: import mathPopulation = int(input("Please Enter the Current Population of Country: "))Birth_rate =…
Q: Question 1 Write an algorithm that lets the user enter several items prices (number of items is…
A: ALGORITHM - STEP 1 - Create while loop and keep taking input from user and store all item prices in…
Q: 4.19 (Sales Commission Calculator) A large company pays its salespeople on a commission basis. The…
A: A large company pays its salespeople on a commission basis. The salespeople receive $200 per week…
Q: Question 1 Write an algorithm that lets the user enter several items prices (number of items is…
A: a loop can be infinite when the condition is true and to exit from the loop immediately break…
Q: Q12.docx > Q/ The following table shows the order of five students degrees in mathmetics, physics…
A: The algorithm for the given input data. Algorithm: step 1 Start step 2 Input S // No of…
Q: I want answer in C Language Research our planet population growing issues online. Get…
A: Code for the question is provided below. - We have used current population that is 7.8…
Q: Q/The following table shows the order of five studenis degrees in mathmeties . physies and english…
A: In step 2, you will get the algorithms. In step 3, you will get the flowchart.
Q: 49. An upper triangular matrix must be square.
A: Given: Determine whether the statement are TRUE or FALSE. Write TRUE if the Statement is True and…
Q: 2. The following table Materi Iron Polystyre Water Air Draw a flowchart th specifically, the algor…
A: Flowchart:
Q: Primary U.S. interstate highways are numbered 1-99. Odd numbers (like the 5 or 95) go north/south,…
A: A required Java program is as follows, File name: “LabProgram.java” import java.util.Scanner; public…
Q: Question 18 D The following question uses a robot in a grid of squares. The robot is represented as…
A: The following code segment moves the robot around the grid. Assume that n is a positive integer.…
Q: nitial value: 15 final grade: 38 multiples: 15 18 21 24 27 38 create an algorithm with algorithmic…
A: Algorithm a. while - do structure Step1: start Step2: Read initial value, final value and number…
Q: Smajors['CS'] = 'Computer Science'; //Line 1 Smajors['MTH'] = 'Mathematics'; I/Line 2 echo "The two…
A: Answer : A mistake was found in line number 3 ie. Line 3.
Q: 2) Minimize the following DFA (use the tabular method explained in the lecture notes and class).…
A:
Q: 3.26 LAB: Interstate highway numbers Primary U.S. interstate highways are numbered 1-99. Odd numbers…
A: As given, I need to write a C program as per the given requirements.
Q: P2 (70%). Assuming that horizontal position is 0, expand the program you developed in P1 in a way…
A: %%%% part2.m %%%%% clc % Assume initial projectile positions % and Initial velocity are…
Q: Q6. Write prolog program that read student grades in AI course to find the number of student with…
A: Actually, program is a executable program that runs on a computer.
Q: 1. Calculate the Overtime Pay for 5 Service men Enter the Service man Name, Enter the Type of…
A: The answer is given below:-
Q: Q/ The following table shows the order of five students degrees in mathmetics , physics and english…
A: While doing programming in any programming language, you need to use various variables to store…
Q: Algorithm: 1. Prompt the user for number of hours. 2. Read the value for hours. 3.…
A: 1. Prompt the user for number of hours.2. Read the value for hours.3. Prompt the user for…
Q: Problem 2: Outlet Service Planning A new restaurant is opening in Egypt. Therefore, the owners will…
A: As you have posted multiple questions, we will solve the first question for you. def…
Q: e the following question correctly with detail please.
A: Binary number to Gray code a) 11011 Procedure Step1. The Most Significant Bit(MSB) of binary code…
Q: Crispies Bagels and Bites wants a program that allows its salesclerks to enter the number of bagels,…
A: Input output flow
Q: Determine whether the following argument is valid or invalid. Include a truth table and a few words…
A: INTRODUCTION: We need to tell the argument is valid or invalid and also create truth table for that.
Q: 7: Exams.cpp) Suppose a teacher weights the four exams he gives 10%, 25%, 30%, and 35%. Write a…
A: The solution is given below:
MATLAB
Step by step
Solved in 2 steps with 1 images
- 22.........a) Write a program that asks the user to enter the number of vertices in a directed graph and then the adjacency matrix representing the directed graph. The program, then, must display the node with the highest outdegree. Assume that nodes are named as 0, 1, 2, and so on.asapAlgorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACTQuestion 18 D The following question uses a robot in a grid of squares. The robot is represented as a triangle, which is initially facing toward the top of the grid. The following code segment moves the robot around the grid. Assume that n is a positive integer.
- Lucky Pairs Richie and Raechal are participating in a game called "Lucky pairs" at the Annual Game Fair in their Company. As per the rules of the contest, two members form a team and Richie initially has the number A and Raechal has the number B.There are a total of N turns in the game, and Richie and Raechal alternatively take turns. In each turn, the player's number is multiplied by 2. Richie has the first turn. Suppose after the entire N turns, Richie’s number has become C, and Raechal’s number has become D, the final score of the team will be the sum of the scores (C+D) of both the players after N turns. Write a program to facilitate the quiz organizers to find the final scores of the team. Input and Output Format:The only line of input contains 3 integers A, B, and N.Output a single line that contains the integer that gives the final score of the team which will be the sum of the scores of both the players after N turns.Refer sample input and output for formatting specifications.…Write T if the sentence is right; write F else, and fix the incorrect one. You need only respond to 5 of the following questions.The get() function may be used to append a new plot to an existing one.3.3.2: Nested loops: Print seats. Given numRows and numColumns, print a list of all seats in a theater. Rows are numbered, columns lettered, as in 1A or 3E. Print a space after each seat, including after the last. Use separate print statements to print the row and column. Ex: numRows = 2 and numColumns = 3 prints:1A 1B 1C 2A 2B 2C
- Homework#7-a Compute the value of factorial 10 using (for) loop. """""""""""""""""""""""""""""""""""""""""""" Homework#7-b Create a square identity matrix using (while) loop, (continue) and (break) . Note: if you want to use (while) loop without condition, you can write, as example: n=5 While n in this case the loop will continue without a condition on (n) value.6.32 LAB: Fibonacci sequence The Fibonacci sequence begins with 0 and then 1 follows. All subsequent values are the sum of the previous two, ex: 0, 1, 1, 2, 3, 5, 8, 13. Complete the fibonacci() function, which has an index n as parameter and returns the nth value in the sequence. Any negative index values should return -1. Ex: If the input is: 7 the output is: fibonacci(7) is 13 Note: Use a for loop and DO NOT use recursion. Use Python, please.1- Each Student Creates the F1 & F2 Equation With Their Own Number For example: Student Number: 249176126876 FI=2X^5+4X^4+9X^3+1X^2+7X^1+6X^0 F2 =1X^5+2X^4+6X^3+8X^2+7X^1+6X^0 For two equations: 1. Perform addition and the result (T) is variable. 2. Subtract and the result (C) is variable. 3. If: X = linspace (-5, 5, 100), plot the relationship between X and T. 4. Do the multiplication and the result (V) is a variable. 5. Divide and the result (A, B) is variable. 6. Introduce (T/F1) as a transfer function in MATLAB. 2- Program the desired operation using MATLAB commands for the given transfer function. write as: H1/H2=2X^5+9X^3+6/X^6+2X^4+8X^2+7X For X=linspace (1, 5, 10), if H1>H2, Draw the relationship between X and H1 or? Draw the relationship between X and H2 Note: Student number to be used in the solution; 207106106015 To be solved using the Matlap program
- please fill in the blanks please fill in the blanks please fill in the blanks please fill in the blanks please fill in the blanks please fill in the blanks 1. For graph defined by G = (V,E), |E| If the value is less than |V |^2, these graphs are ...... called.. 2. For graph defined by G = (V,E), |E| If the value is close |V |^2, these graphs are ...... called. 3. If displayed using graph adjacency list defined by G = (V,E) …….space, if represented by adjacency matrix........... requires space. 4. When disjoint-sets are performed as a linked-list using a pointer from each node to the cluster representative (header node), the findSet operation, which finds which element belongs to which cluster, is the worst (worst case) ............ time, the worst case (worst case) is the union operation that combines the sets of two given elements ............ time requires (total number of elements is n.). 5. In the previous question, if the union operation is done according to the cluster size,…Celebrity problem A celebrity among a group of n people is a person who knows nobody but is known by everybody else. The task is to identify a celebrity by only asking questions to people of the form: ”Do you know him/her?” Solution Select two people from the group given, say, A and B, and ask A whether A knows B. If A knows B, remove A from the remaining people who can be a celebrity; if A doesn’t know B, remove B from this group. Solve the problem recursively for the remaining group of people who can be a celebrity Which design strategy does the following solution use? A-)Decrease-by-a-constant factor algorithm B-)Variable-size-decrease algorithm C-)Decrease-by-a-constant algorithm D-)Divide-and-ConquerAlphabetic Telephone Number TranslatorMany companies use telephone numbers like 555-GET-FOOD so the number is easier for theircustomers to remember. On a standard telephone, the alphabetic letters are mapped to numbers519in the following fashion:A, B, and C = 2D, E, and F = 3G, H, and I = 4J, K, and L = 5M, N, and O = 6P, Q, R, and S = 7T, U, and V = 8W, X, Y, and Z = 9Write a program that asks the user to enter a 10-character telephone number in the format XXXXXX-XXXX. The application should display the telephone number with any alphabeticcharacters that appeared in the original translated to their numeric equivalent. For example, ifthe user enters 555-GET-FOOD, the application should display 555-438-3663 For the attached assignment, write a python program, you also need to write: Comments for all the values, constants, and functions IPO Variables Pseudcode