Q8. Protein synthesis is carried out by the processes of transcription and translation.A short length of DNA is shown:ТАСТCGTCGACGATGATC(a) State how many codons are present.(b) Using the table below, find the sequence of amino acids resulting from thetranscription and translation of the length of DNA. Show your working.Second baseCUUU Phenyl-UUC alanineUCUTFUCCUGUUAU1UAC Tyrosine YUGCFCysteine CStop codonTryptophanU-SerineUCAUUAFLeucine L UCGJUAAUAGStop codon UGAStop codon UGGWSUUGCUUTCUCCUACUGCCUTCAU1CACCGUTCGCCGACAGGlutamine CGGHistidine HFLeucine L CCСА-Proline-ArginineRCAACCG]AAU AsparagineAACIAUUAUC FIsoleucineA AUAACUTACCACAAGU]AGCN.AGA Arginine-SerineSThreonineAAA LysineAUG MMethionine ACG]start codonAAGKAGGGUUTGCUTGCCGCAGCGGAULAsparticGACacidGGUGUCGGUAD-Valine VAlanineGGCGlycineGGGAGAA GlutamicAGAGacidGUGEGGG.(United Kingdom)Third baseDCAG UCAGDCAGUCAGFirst base

Name: Q8. Protein synthesis is carried out by the processes of transcriptio
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Q8. Protein synthesis is carried out by the processes of transcription and translation.A short length of DNA is shown:ТАСТCGTCGACGATGATC(a) State how many codons are present.(b) Using the table below, find the sequence of amino acids resulting from

The transcription is the process by which RNA is produced from the DNA template and the translation…

Science

Biology

Q8. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working.

Q8. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
Q1: Which amino acid always begins an amino acid chain? Which codon and anticodon are associated with that amino acid? Q2: Each of the codons for stopping translation binds to a tRNA molecule that does not carry an amino acid. How would the binding of a stop codon cause the completed amino acid chain to be released? Q3: Given the partial mRNA sequence that you speciﬁed in Figure 10.6’s question 3 as being transcribed from the DNA template strand, what is the amino acid sequence that would be translated?
Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.
Q8. Why do you think it takes three lines to display the amino acid information? Hint: remember that a codon is specified by three bases, e.g., CCG = Proline (circled in Figure 12).
Q1: Why is only one strand of DNA used as a template? Q2: If a mutation occurred within the promoter or terminator region, do you think it would affect the mRNA transcribed? Why or why not? Q3: The template strand of part of a gene has the base sequence TGAGAAGACCAGGGTTGT. What is the sequence of RNA transcribed from this DNA, assuming that RNA polymerase travels from left to right on this strand?
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
Q1: How many codons code for isoleucine? For tryptophan? For leucine? Q2: What codons are associated with asparagine? With serine? Q3: From the partial mRNA sequence that you speciﬁed in Figure 10.6’s question 3 as being transcribed from the DNA template strand, remove only the ﬁrst A. What amino acid sequence would be translated as a result of this change? How does that sequence compare to the amino acid sequence you translated from the original mRNA sequence?
30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of non-coding RNA and a regulatory DNA element.
Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.