Most restriction enzymes (RE's) were isolated from bacteria. Since these bacteria require an intact (i.e. undigested) genome in order to survive, what mechanism protects the genomic DNA of bacteria from digestion by their own restriction enzymes?

Most restriction enzymes (RE's) were isolated from bacteria. Since these bacteria require an intact (i.e. undigested) genome in order to survive, what mechanism protects the genomic DNA of bacteria from digestion by their own restriction enzymes?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 2TYK

See similar textbooks

Related questions

Q: What account for the reduction of levels of soluble carbohydrate and nitrogen of vegetation and…

A: As cattle production rises in America, Africa, and Asia1, grassland lands are becoming more crucial…

Q: (1) What does BLAST stand for? Explain the function of BLAST.

A: Information about bioinformatics is derived through computer analyses of biological data. In…

Q: Why are convergent traits considered evidence for evolution

A: Convergent evolution is the independently occurring evolution of comparable traits in animals from…

Q: In a particular animal, coat color is under the control of two interacting genes. Each gene has a…

A: Introduction:- Genotype is defined as the genetic constitution of an individual organism that…

Q: Your entire genome is about 6.4 billion basepairs long. If 41% of the human genome is either…

A: Genome Genome is the heritable entity of organism which can transfer from parents to their…

Q: In a population, which individuals are most likely to survive and reproduce? (a) The individuals…

A: Population means individuals of people of the same species living in the same environment or area.…

Q: A diploid species has 3 pairs of chromosomes in its somatic cells. In males, the first pair is large…

A: According to the position of centromere present chromosomes can be of different shapes such as…

Q: Use the information in the tables below to determine the most probable number of bacteria per 100 mL…

A: The Most Probable Number (MPN) method, which replicates liquid broth growth in ten-fold dilutions,…

Q: "In a beaker containing 6% NaCl, you place a cell which contains 0.9% NaCl. NaCl doesn t cross the…

A: Introduction : Osmosis is a passive process and happens without any use of energy. It involves the…

Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…

A: Introduction The contour of biological regulation:- It is a way for information processing &…

Q: The percentage of time spent at different physical activity intensities is the same for boys and…

A: Introduction An exercise's difficulty is determined by its intensity, which is often based on how…

Q: 2. The hereunder template shall be used in enumerating the functions if the Digestive Organs: Organ…

A: Introduction: The gastrointestinal tract is a component of the human digestive system, along with…

Q: Can simple technique be used to identify more than the morphological characteristics of…

Q: For the Biosynthetic-secretory pathway, Endocytic pathway and Retrieval pathway: • Where do the…

A: There are two biosynthetic secretory pathways- the regulated pathway and the consecutive pathway. In…

Q: A prokaryotic cell _______ contain lysosomes. A prokaryotic cell _______ contain golgi. Select one:…

A: Prokaryotic cell The cell is the fundamental , structural and functional unit of living organisms.…

Q: How is the booby’s ritual dance a prezygotic reproductive barrier?

A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…

Q: In ______, the gene product can be increased by increasing the number of genes available for…

A: Introduction When the genetic material or DNA sequence is exchanged or rearranged between different…

Q: Which of the following would render the plasma membrane more fluid? Group of answer choices…

A: A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it offers…

Q: Which of the following two organisms are most likely to have the highest degree of homology in their…

A: The relationship between DNA or structures descended from a single most recent ancestor is known as…

Q: Concept Map: Complete the attached Systematics Concept Map. Type your answer on each level in the…

A: Phylogeny is an applicable biological procedure for determining what genus a species belongs to…

Q: Compared to a protein with a low Km, a protein with a high Km possess ________ for the substrate.…

A: Enzymes are proteins and are basically catalyst that increases the rate of reaction. km is the…

Q: sIMILARITIES AND DIFFERENCES ecologist vs. environmentalist

A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…

Q: Which of the following would be the least desirable model species to learn how proteasomes govern…

A: Proteosomes are Special cell organelles which along with ubiquitin form a complex that is involved…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Illustrate simplified region (map) of the lac operon genes. Identify the genes present in this…

A: Lac operon is a control unit that consists of cluster of genes that helps in the metabolism of…

Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.

A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…

Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…

A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: In the garden shed belonging to one of this text’s authors, stabilizing selection has occurred over…

A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…

Q: 3 Allele distributions in Generation 1: 36 homozygous dominant individuals 13 heterozygous…

A: Given p+q = 1 p2 + 2pq + q2 = 1 q = 0.4

Q: Estimate the chronic daily intake of 1,1,1-trichloroethane from exposure to a city water supply that…

Q: What would be the effect on the following processes in a cancer cells treated with Drug X. Match the…

A: Cancer is defined as a condition of uncontrollable cell division resulting in the formation of cell…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Phylogenetic tree is responsible for providing the relationship between the taxons. It also provides…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: Sickle cell anemia is a human genetic disorder caused by an autosomal recessive allele. A couple…

A: Introduction One of the genetic diseases known as sickle cell disease is sickle cell anaemia. Red…

Q: Explain giving reasons the bending of the shoot tip of a plant towards light source coming from one…

A: When a plant bends towards the source of light this is called phototropism. It is the response of…

Q: As a researcher who studies cytoskeletal dynamics, you create a microtubule subunit that cannot…

A: Explanation: The critical concentration for the minus end of a polymer formed by these mutant…

Q: (c) As for the vectors to be used for cloning and expression, suggest two types of plasmids suitable…

A: Genetic engineering has the ability to enhance the flavor of meals, boost nutritious value, and even…

Q: Which of the following helped to lay the groundwork for understanding the record of historical…

A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…

Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…

A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…

Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.

A: According to their shared evolutionary parent, distinct species of animals with similar structure,…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: A trait is a characteristic feature that is unique to particular individual . Each trait is…

Q: Why are vestigial structures among organisms evidence for evolution? Give an example of another…

A: The evolution of various organisms or life forms present on the earth shows that the organisms are…

Q: Second messengers are molecules that relay signals received at receptors on the cell surface to…

A: Introduction : The second messenger or intracellular hormonal mediator that carries information to…

Q: Which of the following are applications of DNA sequencing? Gaining insights into evolutionary…

A: It is the process of determining the sequence of the nucleic acids, the order of nucleotides in the…

Q: In mice, genes R and T are 30 m.u. apart. If a mouse with genotype Rt/rT is crossed with a mouse…

A: Linked gene When two different gene located on the same chromosome then it is said they are linked.

Q: The anterior pituitary releases tropic hormones. The role of these hormones is ... to receive…

A: Tropic hormones are hormones that have other endocrine glands as their target. Most tropic hormones…

Q: Which of these options is NOT an example of a hypothesis that supports the occurrence of ecological…

A: The manner in which the way of means of in which new species turn out to be an end result of…

Q: The endplate potential decreases with distance because

A: The end plate potential is a potential that propagates to the neighbouring patch of muscle fibre…

Question

Can you help with 2 thanks!

2.
Most restriction enzymes (RE's) were isolated from bacteria. Since these bacteria require an intact (i.e.
undigested) genome in order to survive, what mechanism protects the genomic DNA of bacteria from digestion by
their own restriction enzymes?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2 Final answer

VIEW

Step 3 Explanation

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed genes into a mammalian chromosome using restriction enzymes. b. by adding plasmids to the mammalian cells. c. by using engineered viruses as vectors. d. by using a gene gun. 2. If someone is accused of a crime, investigators can collect his or her DNA to compare the DNA of the cells found at the crime scene. To collect human DNA, investigators often swab the inside of person’s cheek. Just a few human cheek cells contain enough material to perform PCR. In a cell, the nucleus and mitochondria contain DNA that is the starting material for PCR. Identify the 4 components needed to start a PCR reaction (equipment not included)
2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form phosphodiester bonds when DNA are assembled Palindromic sequences are recognized by restriction enzymes Restriction enzymes recognize blunt ends Restriction enzymes recognize sticky ends Restriction enzymes originated from bacteria
What information and materials are needed to amplify region of DNA using PCR?
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
1. Write if the statement is true and modify the statement with the correct answer if its false a.White colonies represent those bacteria that do not express the genes for beta-galactosidase because restriction enzymes have cut the gene and ligase have not repaired the break b.Antibiotic resistance genes in bacterial transformation are used as marker genes because of ease of detection of transformants. c. Bacterial transformation simply means the insertion of a recombinant plasmid into a bacterial cell.
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1. The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
9) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)
4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.