4 O1&2O 2 & 3QUESTION 4You label T2 bacteriophage with radioactive sulphur and use these to infect a new e.coli culture that has no radiation. After infection,you centrifuge the infected cells and transfer the pelleted bacterial cells to new media. After letting the T2 phage that infected thisbacteria replicate, you will find your new phage are also radioactive.O TrueO FalseQUESTION 5A double stranded DNA molecule is 500 base pairs long and is comprised of 27% thymine. What is the base composition of the otherthree bases in percentages?O A=27%, C=D23%, & G=23%O A=27%, C=27%, & G=27%O A=23%, C=23%, & G=27%O A=23%, C=27%, & G=27%O This doesn't not follow Chargaff's ruleClick Save and Submit to save and submit. Click Save All Answers to save all answers.Save All Ansstv1720OMacBook Air

Name: 4 O1&2O 2 & 3QUESTION 4You label T2 bacteriophage with radioactive sul
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 4 O1&2O 2 & 3QUESTION 4You label T2 bacteriophage with radioactive sulphur and use these to infect a new e.coli culture that has no radiation. After infection,you centrifuge the infected cells and transfer the pelleted bacterial cells to new media. A

In this question we have to describe about phage DNA and its tagging with radioactive isotope.

Science

Biology

QUESTION 4 You label T2 bacteriophage with radioactive sulphur and use these to infect a new e.coli culture that has no radiation. After infection, you centrifuge the infected cells and transfer the pelleted bacterial cells to new media. After letting the T2 phage that infected this bacteria replicate, you will find your new phage are also radioactive. O True O False

QUESTION 4 You label T2 bacteriophage with radioactive sulphur and use these to infect a new e.coli culture that has no radiation. After infection, you centrifuge the infected cells and transfer the pelleted bacterial cells to new media. After letting the T2 phage that infected this bacteria replicate, you will find your new phage are also radioactive. O True O False

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 3DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
1. In his transformation experiments, what did Griffith observe? a. Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form b. Mixing a heat-killed nonpathogenic strain of bacteria with a living pathogenic strain makes the pathogenic strain nonpathogenic c. Mutant mice were resistant to bacterial infections. d. Infecting mice with nonpathogenic strains of bacteria makes them resistant to pathogenic strains
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
In a genetics lab, Kim and Maria infected a samplefrom an E. coli culture with a particular virulent bacteriophage. They noticed that most of the cells werelysed, but a few survived. The survival rate in theirsample was about 1 × 10−4. Kim was sure the bacteriophage induced the resistance in the cells, whileMaria thought that resistant mutants probably alreadyexisted in the sample of cells they used. Earlier, for adifferent experiment, they had spread a dilute suspension of E. coli onto solid medium in a large petri dish,and, after seeing that about 105colonies were growingup, they had replica-plated that plate onto three otherplates. Kim and Maria decide to use these plates totest their theories. They pipette a suspension of thebacteriophage onto each of the three replica plates.What should they see if Kim is right? What shouldthey see if Maria is right?
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
In the Hershey-Chase experiment with bacteriophages, (a) harmless bacterial cells permanently transformed into virulent cells (b) DNA was shown to be the transforming factor of earlier bacterial transformation experiments (c) the replication of DNA was conclusively shown to be semiconservative (d) viral DNA was shown to enter bacterial cells and cause the production of new viruses within the bacteria (e) viruses injected their proteins, not their DNA, into bacterial cells