Q: Question #53
A: Glucose is the preferred biomolecule for the generation of ATP inside cells. Glucose is either…
Q: 58 59 please answer all
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: Please do these fast and please tell short answers
A: -Growth rate can be simply defined as the percentage growth after accounting for the births and…
Q: Which is the correct answer for these 2 questions
A: A viral infection is the spread of a contagious virus in the body. Viruses are unable to replicate…
Q: Questions no 8
A: We know that In the prostate gland, the development of a cell is out of control that causes prostate…
Q: Question 34 quickly fast answer asap
A: We know that Stroke is a medical emergency condition. This occurs when the brain won't get enough…
Q: Question 36 HCN channels are activated by hyperpolarization and gated by nucleotides
A: Note: We are authorized to answer one question at a time since you have not mentioned which question…
Q: Answers for only the last three
A: In the laboratory, certain biochemical reactions are performed in order to check the presence and…
Q: 14 16 四日 11
A: Cell is the basic structural and functional unit of life. It is made up of various organalles which…
Q: swer this question immediately. .
A: As we know Centrifuge is a device that is commonly used in laboratories. It is based on the…
Q: Question number 2
A: The kidney is a bean-shaped organ found in all vertebrates; it is present in the left and right…
Q: QUESTION 9
A: Reason: When compared to other options i.e., Histology had no cilia (so eliminate option D) and…
Q: answer each part with increase or decrease
A: The term amino acid is short for α-amino [alpha-amino] carboxylic acid. Each molecule contains a…
Q: Please answer question 4&5.
A: INTRODUCTION Fraud, waste, and abuse are a major threat for healthcare round the world. An estimated…
Q: Please do both
A: In human body, the circulatory system and respiratory system works together to sustain the life.
Q: Question 3
A: Lamarckism or Lamarck's theory of evolution states that the changes acquired in the body of an…
Q: lowing question:5
A: A stressor is a chemical or biological substance, an environmental setting, an external trigger, or…
Q: Answer for the number 1 question. Thank you. No need for long explanation.
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: answer ii ,iii, and iv only
A: A gene is the physical and functional unit of heredity. The genes are made up of DNA.
Q: Question number 2 and 3
A: Starch is a carbohydrate, more particularly a polysaccharide, that is found in bread, cereals,…
Q: answer that attaced question
A: Restriction endonucleases are enzymes that act as molecular scissors and cut the DNA molecule at a…
Q: Do question 14
A: Chemoautotrophs
Q: Answer question number 2
A:
Q: Please answer question 3 with full steps. Thanks in advance!
A: Phenotype refers to the observable properties of an organism as a complex outcome of inherited…
Q: Solve the question
A: Proteins are complex macromolecules made of monomers called Amino acid . These complex molecules is…
Q: Choose a match ...
A: A mushroom or toadstool is the fleshy, spore-bearing fruiting body of a fungus, typically produced…
Q: Answer- 0
A: We know that cellular respiration is the process in which breakdown of food will take place and it…
Q: Identify A and B
A: The heart is derived from mesoderm. The heart is located in the thoracic cavity. It has four…
Q: 6--
A: As we know The molecules that have more electrons at one end than the other are said to be polar of…
Q: Can you answer question 6 please
A: There are beneficial bacteria in the gut,the gut microbiota contains over 3 million genes, making it…
Q: Question 2 and 3a
A: Since you have asked multiple question, we will solve the first question for you. Anatomy is the…
Q: Answer question no. 2
A: The gestation period is the time of fetal development and growth from the point of fertilization in…
Q: Please answer 28-31
A: Introduction: Macromolecules are those biomolecules that needed in large quantities. These molecules…
Q: Question 19
A: There are total 17 alleles and we will find the answer by using the formula for the sum of…
Q: Question 11 10 In the center of the embrvO sac are the:
A: The answer is polar nucleus
Q: Please answer question 3
A: The most abundant and diverse plants are the flowering plants known as angiosperms . These seed…
Q: please solve question 7
A: The members of electron transport chain involved as electron carriers are complex I, complex II,…
Q: ursing question 0/.
A: First Aid : First aid is the first and immediate medication is given to the person suffering from…
Q: 5- عندما تتكاثر الفطريات لا جنسيا وجنسيا هل تعتقد آنها من تتكاثر جميعها بكل الطرق التي ذكرت للتكاثر…
A: Perfect fungi reproduce both sexually and asexually, while imperfect fungi reproduce only asexually…
Q: 2)
A: Different types of coiling occurs in molluscum. Mainly coniospiral and planispiral coilings are…
Q: Question..
A: Heart sounds are generated by the flow of blood in and out of the heart chambers. These sounds are…
Q: ANSWER THE 4 QUESTIONS AND WRITE THE CORRECT LETTER FOR EACH NUMBER
A: Sensory receptors are specialized epidermal cells that respond to external stimuli, and they are…
Q: Question 2
A: A homeostasis is a state of continued steady balance of physical and chemical condition maintained…
Q: Answer this question correct
A: There are two types of therapy: physical therapy or physiotherapy and occupational therapy. The…
Q: Question 21 and 22 please
A: In evolutionary biology various diagrams are made to show the evolutionary relationship between the…
Q: Question 3a and 3c.
A: DNA replication Process during which a double stranded DNA molecule is copied to produce two…
Q: Choose a match
A: The image shown is a plant having genus Lycopodium. It is a genus of clubmosses, also known as grown…
Q: II II IV
A: Amino acids are usually grouped on the surface of protein on the basis of theri charge and polarity…
Q: Question 1 only !
A: Preclinical testing Preclinical investigation of drugs is done to check weather this drug is…
Q: Complete table and answer questions 2,3,4.
A: Osmolarity :- The concentration of a solution expressed as the total number of solute particles per…
Step by step
Solved in 2 steps
- Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?Wild-type E. coli takes up and concentrates a certain redfood dye, making the colonies blood red. Transposonmutagenesis was used, and the cells were plated on fooddye. Most colonies were red, but some colonies did nottake up dye and appeared white. In one white colony, theDNA surrounding the transposon insert was sequenced,with the use of a DNA replication primer identical withpart of the end of the transposon sequence, and the sequence adjacent to the transposon was found to correspond to a gene of unknown function called atoE, spanning positions 2.322 through 2.324 Mb on the map(numbered from an arbitrary position zero). Propose afunction for atoE. What biological process could be investigated in this way, and what other types of white colonies might be expected?Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
- Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeIn the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates onlywhen the cycle ends (or when a random end of DNA isencountered). Yet, by the end of 20 to 30 cycles—a typicalamplification—the only visible product is defined pre-cisely by the ends of the DNA primers. In what cycle is adouble-stranded fragment of the correct size first gener-ated?
- In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the extraction method produced short fragments of DNA. Whatsort of results might have been obtained with longer piecesof DNA?3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
- Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?Researchers who study the molecular mechanism of transformationhave identified many proteins in bacteria that function in theuptake of DNA from the environment and its recombination intothe host cell’s chromosome. This means that bacteria have evolvedmolecular mechanisms for the purpose of transformation by extracellularDNA. What advantage(s) does a bacterium derive from importing DNA from the environment and/or incorporating it into its chromosome?