XRemoval of introns requiresa poly-A tail.a 5' cap.RNA polymerase enzymes.curling to the enhancement site.the action of Spliceosomes. XThe small ribosomal sub-unit is responsible forthe binding site for tRNA.releases the amino acid to form peptide bonds.attaching to mRNA.organizing ribosomal proteins.releasing the completed polypeptide.

Name: XRemoval of introns requiresa poly-A tail.a 5' cap.RNA polymerase enz
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: XRemoval of introns requiresa poly-A tail.a 5' cap.RNA polymerase enzymes.curling to the enhancement site.the action of Spliceosomes. XThe small ribosomal sub-unit is responsible forthe binding site for tRNA.releases the amino acid to form peptide b

Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Answered: Removal of introns requires a poly-A…

Science

Biology

Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the enhancement site. the action of Spliceosomes.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNA
Which of the one of the following parts of the gene will NOT be included in the RNA it encodes? Answer based on the primary RNA, before any processing has occurred. Intron Exon Promoter UTR
In forming the lariat structure during splicing which of the following attaches to the branch point adenine? 5’ end of exon 1 5 ‘end of exon 2 5’ end of the intron 3’ end of exon 1 3’ end of the intron
Which three codons what code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA A. AGU-UCC-CCG B. AGU-UCG-CCC C. AGC-UCA-CCU D. AGC-UCU-CCU
Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence:
Anticodons are found on ____________ and they contain _____________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3 d. mRNA, 4
What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality. Then write the sequence of the lagging strand in replication of the below strand. ATTCCGAGTCAAGAA
The _____ loop complementary base pairs with the ______ on the mRNA. Codon, Anticodon Anticodon, Codon
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names will be used so mark "none") 1.) 5' AUG 3', Aminoacyl site, Anticodon, N terminus, 5' end of tRNA. 2.) 5' end of DNA template strand, intron, 3' UTR, Codon, amino acid, Promoter
DUE IN 30 MINUTES. Thank you! A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequences would be produced as a result of transcription?
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)