BookrencesLabel the parts of the DNA replication fork.DNA ligaseLeadingstrandOkazakifragmentDNApolymerase IOpen betaclampRNA primerNew bases.WDNA helicaseDNApolymerase IIINew basesClosed betaclampParent DNADNA gyraseClamp loader5 of 25wwwDNA primaseSingle-strandbinding proteinsNext >

Name: BookrencesLabel the parts of the DNA replication fork.DNA ligaseLeadi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: BookrencesLabel the parts of the DNA replication fork.DNA ligaseLeadingstrandOkazakifragmentDNApolymerase IOpen betaclampRNA primerNew bases.WDNA helicaseDNApolymerase IIINew basesClosed betaclampParent DNADNA gyraseClamp loader5 of 25wwwDNA primase

DNA replication, as used in molecular biology, is the biological method for creating two identical…

Science

Biology

Label the parts of the DNA replication fork. DNA ligase Leading strand Okazaki fragment DNA polymerase I 5 mommy Open beta clamp RNA primer New bases- DNA helicase DNA polymerase III New bases Closed beta clamp Parent DNA DNA gyrase Clamp loader 5 5' DNA primase Single-strand binding proteins

Label the parts of the DNA replication fork. DNA ligase Leading strand Okazaki fragment DNA polymerase I 5 mommy Open beta clamp RNA primer New bases- DNA helicase DNA polymerase III New bases Closed beta clamp Parent DNA DNA gyrase Clamp loader 5 5' DNA primase Single-strand binding proteins

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers at the leading and lagging stranda) dna ligaseb. dna proteinsc. dna gyrased. single-strand binding proteinse. primasef. helicaseg. 5' - 3' polymeraseh. RNA polymerasei. other:_
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?
You are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?
In the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates onlywhen the cycle ends (or when a random end of DNA isencountered). Yet, by the end of 20 to 30 cycles—a typicalamplification—the only visible product is defined pre-cisely by the ends of the DNA primers. In what cycle is adouble-stranded fragment of the correct size first gener-ated?
Treating the DNA samples with heat will break the hydrogen bonds holding the moleculestogether. Slow cooling will allow the molecules to renature, but not necessarily with theoriginal partner. If the mechanism for replication is conservative, how would heattreatment change the results?
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.