Q: Often mutations in cyclin dependent kinases, CDKs, can cause cancer. This is because a. CDKs…
A: Cyclins are one which drives the cell cycle events by working with enzymes called Cyclin-dependent…
Q: You would expect to find chromatin in which form during the Gap2 phase of the cell cycle? Replicated…
A: G2 phase of the cell cycle is an interphase which ensures that cell is ready to enter the mitotic…
Q: In an animal cell at mitotic metaphase, you would expect to find (a) two pairs of centrioles located…
A: Centrioles are the paired organelles present in some eukaryotic cells only.
Q: It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of…
A: During the synthesis phase (S-phase) of cell cycle the DNA replication occurs. DNA replication is…
Q: The term heterochromatin refers to heavily condensed regions of chromosomes that are largely devoid…
A: The cell cycle is the sequence of events that occurs in cell results in the division of cytoplasm,…
Q: Metaphase to Anaphase Are all the chromosomes attached to the spindle and aligned properly at the…
A: The cell cycle is a genetically controlled series of changes through which a newly formed cell…
Q: Imagine that there are mutations in the CDK genes such that their gene products are nonfunctional.…
A: Cyclin-dependent kinases (CDKs) are the families of protein kinases first discovered for their role…
Q: 0. The S phase stands for synthesis, which means to make or build something more complex out of…
A: The cell cycle is a sequence of events by which a cell duplicates its genome and synthesis other…
Q: Human cells divide every day for normal growth, replacement of cells, and tissue repair. The…
A: The epidermal growth factor receptor (EGFR) is a transmembrane protein, which acts as a receptor for…
Q: The value of "n" in the field mouse is 20. How many chromatids are in a somatic mouse cell at the…
A: Answer :- Option (B) is correct. - 40.
Q: Which of the following events occurs in metaphase? Multiple Choice Spindle disappears Nuclear…
A: Cell division is responsible for the generation of new cells. The type of cell division that…
Q: The interphase is the part of the eukaryotic cell cycle that is most transcriptionally active. Gene…
A: DNA is the genetic material that transfers the information from one generation to the other. It is…
Q: Which of the following occurs during the G2 stage of interphase? a.The cell undergoes mitosis.…
A: Cell cycle is the organized sequence of events which takes place in a cell for preparation of cell…
Q: Just answer, no need to explain. During prophase of mitosis Select one: A.the spindle breaks…
A: Disclaimer: As per Bartleby guidelines, we will answer only the first question. Kindly repost the…
Q: Cells that DO NOT divide or participate in the cell cycle are usually arrested in what phase? a.…
A: Option d is the answer. G0 phase is the one,where cells are in quiescent stage and donot participate…
Q: A) Which step (A,B, or C) is necessary to allow metaphase to anaphase transition?.. Mad2 АРС/С BubR1…
A: 1) Disbanding of the linkages that keep the chromatids together is the cause of chromosome…
Q: chromosome replication occurs during
A: Cell division is a prominent process that takes place in our body. During cell division in…
Q: Disdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur…
A: A series of events which takes place in a cell due to which it divides and forms two daughter cells…
Q: Independent assortment occurs mainly during which phase? Prophase I Metaphase I…
A: The law of Independent assortment was proposed by Mendel. According to this law, alleles of two…
Q: In a normal cell, signals from the external environment play a role in determining whether the cell…
A:
Q: DNA polymerase III can correct replication errors through its ________ activity. a. 3’ to 5’…
A: Introduction: Although DNA replication is a highly precise process, errors such as a DNA polymerase…
Q: The diagram shows the two forms of a cukaryotic chromosome that occur during the cell cycle. For…
A: In the nucleus of each cell the DNA molecule is packaged into thread like structure buy special…
Q: When does DNA replicate during the cell cycle? metaphase the G2 phase of interphase the S phase of…
A: Cell division is a phenomenon during which parent cell undergo splitting process so as to give rise…
Q: Why would it be important to replicate DNA before a cell divides in mitosis or meiosis? For genetic…
A: Mitosis produces two identical nuclei from the original nucleus. Meiosis, on the other hand,…
Q: Cell A is actively engaging in growth and division. The cell encounters a damage in its DNA at a…
A: Introduction: The restriction point or R-point denotes the start of a cell cycle (G1/S phase).…
Q: The mitotic spindle is often described as a microtubule based cellular machine. The microtubules…
A: The cytoskeleton is made up primarily of microtubules. They are present in all eukaryotic cells and…
Q: During interphase of the cell cycle, a muscle cell was determined to contain less mitochondria than…
A: The cells are the unit of life. based on the number of cells and organism may be unicellular or…
Q: During which part of the cell cycle does DNA replication occur and why is it important? Select one:…
A: A cell cycle consists of a series of events which is required for growth and division of cells. A…
Q: 1 2 3 4 Here is a replication fork during S phase of the cell cycle. DNA strands are labeled 1-4.…
A: Semiconservative DNA replication The replication of DNA takes place in S phase of the cell cycle…
Q: Which of the following events happen during interphase? CHOOSE ALL THAT ARE CORRECT. A) DNA…
A:
Q: During which of the following phases of the cell cycle will chromatins be found containing two…
A: Cell cycle The cell cycle of a cell is divided into 4 main stages the G1 phase or gap 1 phase, S…
Q: Which of the following scenarios accurately describes the actions occurring during the S phase? Each…
A: Cell division is a process in which parent cells divides into daughter cells. There are two types of…
Q: Which of the following scenarios accurately describes the actions occurring during the S phase? O…
A: Cell cycle has different stages called G1, S, G2, and M. In each phase cell does different work by…
Q: Base on your understanding, is the cell cycle efficient? If you can insert or modify steps to make…
A: Introduction :- Cell cycle is defined as the orderly sequence of events in which cell duplicates…
Q: (LT#2) . DNA is coiled & condensed into chromosomes so it can A. be packed into a small, organized…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: (a) What is the centrosome? (b) Cytoskeletal elements play important roles in cell division. The…
A: A centrosome is responsible for organising micro-tubules in the process of cell division. These…
Q: 1) The activity of the cell cycle is controlled by the abundance of: A) protein ligases and…
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: DNA molecules are repeated during which step of the cell cycle? Explain how chromosomes'…
A: DNA is the genetic material in organisms . DNA is condensed around histone proteins to form…
Q: Dolly the Sheep, was born in 1996 in Scotland. She was the first mammal ever cloned from a single…
A: Cell division is the process by which two daughter cells are formed from a single parent cell. It is…
Q: Which phases of the cell cycle is generally the longest in the cells of a mature eukaryote
A: Cell cycle is a cascade of events for the growth and development which a cell undergoes basically…
Q: a Where in the cell does DNA transcription take place? extranuclear region nucleus both the nucleus…
A: Transcription and translation is two of the most important functions occurring in the cell. In…
Q: Oscillations in the activity of which protein family propels the cell cycle forward and creates…
A: Cyclin dependent kinases are the families of protein kinase first discovered for their role in cell…
Q: cell cycle? A. MPF phosphorylates proteins that triggers the activation of M phase B. MPF…
A: MPF acts as a Protein kinase that helps in the transfer of the phosphate group from ATP to the…
Q: What celluar events/processes are associated with G1,S,G2,and M phases of the cell cycle? With the…
A: Mitosis is a mode of cell division in which one cell divides into two cells.
Q: When studying living cells in a laboratory, researchers sometimesuse drugs as a way to cause cells…
A: A sequence of stages known collectively as the cell cycle are actively separated by eukaryote cells:…
Q: The interphase is the part of the eukaryotic cell cycle that is most transcriptionally active. Gene…
A: Chromatin is a nucleoprotein complex. Chromatin is present in the G0 and interphase of cell cycle.…
Q: 4. The diagram below shows cells in various phases of the cell cycle. Note the cells are not…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…
Q: multicellular organisms, nondividing cells stay in G0 phase. For the cell, why is it better to be…
A: Cells first enter into the G0 phase from a cell cycle checkpoint then in the G1 phase, there are…
Q: The next question that we can ask now is "How long does it take for a cell to take one complete…
A: Cell division is the process by which cell divided into identical cells in cell cycle they are there…
Reproduction of the DNA occurs during (????) of the cell cycle.
M Phase
G1 Phase
G2 Phase
S Phase
G0 Phase
What are the mRNA base triplets that correspond to a specific amino acid called?
Ribocodes
Triskellions
Modules
Codons
Step by step
Solved in 2 steps
- It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).Which of the following statements about heterochromatin is FALSE? It contains many repeated sequences, but few actively transcribed genes. It remains condensed through most of the cell cycle. It is found next to the centromeres and on short arms in human chromosomes. It is enriched for transposable elments Histone proteins in heterochromatin are heavily acetylated, reducing their affinity for the DNA backbone.Scientists are able to isolate cells in various phases of the cell cycle. During an experiment in which Dr. Patrick McGroyn is causing cultured tumor cells to go through mitotic cell division, he isolates a group of cells that contain one and a half times more DNA than cells isolated in the G1 phase have. What phase must these cells be in? How do you know?
- A somatic cell has 46 chromosomes aligned at metaphase. How many chromosomes are present at anaphase, immediately after the centromeres have split?If a mad scientist hands you a cell culture with 100 cells that just entered g1. He needs to extract the MOST possible DNA from 100 cells. On top of that, he requires that the DNA cannot be condensed. To accomplish this goal he gives you a set of chemicals that will stop a cell in any part of the cell cycle you want. What part of the cell cycle would you stop the cell at, that matches those requirements?The somatic cell of a sheep contains 54 chromosomes54 chromosomes (2?=54).(2n=54). How many chromosomes and how many DNA molecules would the primary oocyte of this sheep have? chromosomes: DNA molecules:
- Which of the following events happen during interphase? CHOOSE ALL THAT ARE CORRECT. A) DNA replication b) centriole duplication c)increase in cell size d) separate of sister chromatids e) assembly of the mitotic spindle f) formation of the nuclear envelopeWhich of the following is associated with active chromatin? Check all that apply. A. Centromeres B. heterochromatin C. histone acetylation D. Polytene puffs E. metaphase chromasomes F. transcription of machineryMetaphase to Anaphase Are all the chromosomes attached to the spindle and aligned properly at the equator of the cell?
- DNA molecules are repeated during which step of the cell cycle? Explain how chromosomes' kinetochores function. The California two-spot octopus (Octopus bimaculoides) has 28 chromosomes in a diploid cell. Mitosis occurs in the cell. In each daughter cell, how many chromosomes do you have?Oscillations in the activity of which protein family propels the cell cycle forward and creates abrupt transitions between different cell cycle states? prophases kinetochores cyclin-dependent kinases microtubulesWhat is a chromosome? How many chromosomes are in humans? 2.- What are the phases of the cell cycle? Why are important? 3.- a: What is the interphase ? b: Please explain the phases of the interphase. 4.- Why the cells are capable to maintain the homeostasis? 5.- Please name the organelles in the cell, and explain Golgi Apparatus, and Nucleolus: __________________.