Return whether the pattern was found or not (found), the number of times the pattern was found (n), all starting positions at which the pattern was found (positions) and the number of comparisons.""" Given text: CAGTCAGTCATCATGCGTATCAGCTGATC  TATCGGGCGCGCGCGTATCATC Combinations to look for: TGCGTATCAGCT CGCGCG TAT GTCA

Q: 9. e f 6. 11 d. 14 9. 10 15 a 7 b

A: Here in this question we have given a graph and we have asked to apply kruskal algorithm to find…

Q: which operators would make the following statement FALSE? 11_ 2 Matlab

A: To which operators would make the following statement FALSE? 11_2

Q: One state diagram showing page navigation of your project on browser or app. In this state diagram,…

A: State Diagram Definition: A circuit diagram is a type of diagram used in computer science and…

Q: What factors contribute to the poor performance of wireless networks in contrast to wired networks??

A: Unwired networks, often known as wireless networks, are computer networks that use remote…

Q: n't do incorrect Please

A: according to the question Here in this question decoder is connected with the nand gate so firtly we…

Q: Oj is a cruel but wise student of his class. Because of his bad habits, one day his math teacher got…

A: Input/Output Explanation: The first line of the input contains an integer T denoting the number of…

Q: 2. Examine the dendrogram: How many clusters seem reasonable for describing the data?

A: explain dendrogram.

Q: Which component ið uded to compile, deblug and execute the java pHOgsiam8?

A: I have provided answer in step 2.

Q: If you have a presentation, what you have to say to 1. State your topic. 2. Show why your topic is…

A: A presentation conveys information from a speaker to an audience. Presentations are typically…

Q: 2. Design a program that will get the factorial (n!) of an inputted number. FILENAME: MP9.cpp creen…

A: Steps in program: Take n as input Take fact and initialise it to 1 Iterate from 1 to n Multiply…

Q: Q15. . requires more memory space ... than . . *

A: Introduction: Doubly linked list and circular doubly linked list has two pointers that are 'prev'…

Q: 3- Show to connect two 7482 adders to form a four-bit adder? 4 Ora

A:

Q: Which of the following Boolean expressions accurately describe a fire alarm circuit that turns on a…

A: In the statements the each separated with "and" will be used as Logical AND and statements separated…

Q: Person -Extends Extends Student Employee -Extends Extends Faculty Staff

A: The code is attached below in step 2

Q: Write a program to display the grade and grade point for a subject when the user key in their mark…

A: #include <iostream>using namespace std; int main(){    int marks;    int choice;…

Q: A "memory hole" is something that happens in your computer's memory. And how does the operating…

A: Answer: Memory hole: A memory hole is any way of deliberately altering or disappearing texts,…

Q: A "memory hole" is something that happens in your computer's memory. And how does the operating…

A: Memory Hole: A Memory hole is any mechanism for the planned alteration or disappearance of…

Q: Machine Problem Using for statement Write a C++ program that will display the sine, cosine and…

A: I give the code in C++ along with output and code screenshot

Q: Write a program that will determine if a number is positive or negative. If positive it should be…

A: Given: Write a program that will determine if a number is positive or negative. If positive it…

Q: OUTPUT CONSOLE Please insert number of students: 5 Please insert Student 1's mark: 20 Please insert…

A: Input : Input marks Output : Average marks of students.

Q: Cource : Data structure (please read the following bolded words !!!!!!) Write the code in C++ and…

A: Employee record management system using linked list in C++

Q: Re-write the program given to generate the outputs as the images shown   void setup() { size(800,…

A: The solution for the above-given question is given below:

Q: write a C program, named sysconf, that prints configuration information at runtime

A: Answers Syntax #include <unistd.h> long sysconf(int name);   Service Program Name: QP0LLIB1…

Q: nd the register that introduces the dependency. Highlight it if it is Load- nstruction that writes…

A: I have  answered below:

Q: RODU PRODUCTNO PRODUCTWEIGHT PRODUCTPRICE PRODUCTINVENTORY PRODUCTTYPE 01 -02 03 "04 -05 101 10 30…

A: Requirement: To fetch duplicate records in the given table.   Duplicate records can be fetched using…

Q: What is Turing machine (TM) and what is the purpose of it?

A: Turing machine was invented in 1936 by Alan Turing.  It is an accepting device which accepts…

Q: Q16. Which character is at the top of the stack after performing the operations: Push ('X') , Push…

A: Stack: A Stack is a linear data structure. It works on the principle of LIFO(Last In First Out) or…

Q: 4. Create a program that displays a 10x10 multiplication table.

A: To write a program to display that 10*10 multiplication table.

Q: Design and implement an assembly program using sim8085 and upload the implementation interface of…

A: it requires basics of assembly language. A simple loop , add and Move commands understanding is…

Q: What are the aspects of a threat posed by passive smelling, and how does it manifest itself?

A: While sniffing technology can be used to test telephone connections and determine the call's…

Q: int main() int i = 3, j, k: i-&i; k= i; j- 10; cout <<i ji+ jk: return 0; 30 3 O 20 20 O 10 20 O 10…

A: Your answer is given below with an explanation.

Q: code required for python:  For this question, you will be required to use the binary search to find…

A: import numpy as npdef binary_search(f,domain, MAX = 1000):    start ,end = domain # get the start…

Q: What is the difference between a reader-writer lock and a "regular" lock?

A: A lock is a mechanism to maintain limits on access to resources in a computer system when there are…

Q: What is the definition of one's complement?

A: In representing signed binary numbers, 1's complement is very significant. The 1's complement is…

Q: After doing the following statement, the linked list becomes P.Link = Head Head 3000 4800 10 4900 15…

A: Answer is given below :

Q: Explain how Jason Hickel's De-development framework and Martin Heidegger's The Question Concerning…

A: Given: That's a lot to consider, but I assume you already know how they're linked because you asked…

Q: A struct is a class with its members public by default. Select one: True False

A: A structure is a user-defined data type in C/C++.  It group items of different types into a single…

Q: A router has the following Access Control List c

A: Given :- In the above question, the access control list is defined in the above given question…

Q: Answer the following questions (and justify your answers): 1. Can a Turing machine ever write the…

A: A turing machine is a mathematical model machine which accepts recursive language.

Q: What is the code to align Name, Score1, Score2, Score3 in Form-Load(). Select and apply passing…

A: Python: Python is a general purpose programming language developed by Guido Van Rossum in 1989.…

Q: In what ways are paradigm shifts justified?

A: Refinements: This is the process of removing some of the unwanted materials from the mind's material…

Q: Construct a flowchart for Base Conversion Module to illustrate the codes below.* #include using…

A: A flowchart for Base Conversion Module

Q: Give a greedy algorithm to construct a k × n matrix of rank k(Generator matrix) for a [n,k,d]q code.…

A: Given  а  3-D  аrrаy  аrr[l][m][n],  the  tаsk  is  tо  find  the  minimum  раth  sum  frоm  the…

Q: (a) Let H, K be subgroups of a group with identity e, such that |H| = 20 and |K| = 45. Determine |H…

A: According to the information given:- We have to define and prove the |H intersection K| not equals…

Q: Q4.A committe of 4 students is selededt Yandom fem agroul aonsPsting 8 boys mel 4 JirL Gfuen that…

A: We are going to find the probability that there are exactly 2 girls on the committee. Probability=…

Q: 5. Some banks make debtors pay in round, yearly amounts. Make a program that would input a loaned…

A: Answer

Q: Design a synchronous counter, using JK flip-flops and NOR (OR-INVERTED), for the following sequence:…

A: Answer: Synchronous counter, using JK flip-flops: State transition diagram:

Q: What factors contribute to the poor performance of wireless networks in contrast to wired networks??

A: A wireless network is a computing network that uses distant information linkages between network…

Q: What are the difficulties that firms face while attempting to migrate to a cloud-based…

A: Challenge faced by a firm while migrating to a cloud-based infrastructure are: Financial Cost: The…

Q: Python Code: Oj is a cruel but wise student of his class. Because of his bad habits, one day his…

A: The answer is given below.