Sequence dideoxy sequencing

Q: annotate completely

A: Answer: Introduction: Eukaryotic cells are the cells which have true nucleus and membrane bound…

Q: Artificial insemination

A: Reproduction is the process of production of own kids by living beings.

Q: are dit View Insert Format Tools Table

A: Parenchyma cells are one of the most common cells found in plants that presents in most of its part…

Q: Cons of CRISPR

A: The cons or disadvantages of CRISPR  are as follows:

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.

A: DNA Replication  In the process of DNA replication, the DNA makes multiple copies of itself. It is a…

Q: Primary protein structure. Protein sequencing. Edman's method.

A: Proteins are one of the fundamental components of living organisms.

Q: Collection of microscopic DNA spots attached to solid surface area) Orthologb) Syntenyc) Paralogd)…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Tagging systems available in pET vectors.

A: A potent and popular method for expressing recombinant proteins in E. coli is the pET vector system.…

Q: DNA Fingerprints Cat Kittens IL || ILL || I I

A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…

Q: developer/designer.

A: A web developer would be responsible for  using various  components like the engine , transmission…

Q: Write a Good background introduction about DNA and why its important to extract it.

A: Nucleic acids are of two types – DNA and RNA. DNA is the genetic material in humans. It is composed…

Q: Microscope Parts Worksheet

A: The laboratory device used to see things that are too small in size to be seen by naked eyes is…

Q: Why is Research is now an integral activity in the organizations?

A: Research is a study which is detailed and careful in order to find out more information about the…

Q: le novo biosynthetic pathwa

A: A nucleotide is the basic building block of nucleic acids. RNA and DNA are polymers made of long…

Q: CRISPR in summary

A: CRISPR stands for clustered regularly interspaced short palindromic sequence. It's the gene editing…

Q: Cxikeria DNA Transcription Translation Location

A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…

Q: common molecular marker,

A: Molecular marker: It is a fragment of DNA which is associated with a certain location within the…

Q: Amplification and cloning stepwise procedure with enzymes

A: gene cloning is a process in which involves the separation of the DNA fragment from the interested…

Q: restriction enzyme“

A: Restriction Enzyme Restriction enzymes are enzymes that helps in the cleavage of DNA into different…

Q: Summary on how to use a spectrophotometer DNA nanodrop

A: Summary Steps  1*Open the computer attached to Nanodrop.  2*Wash the Nanodrop pedestal.  3*Open the…

Q: Write process/steps on how to culture the bacillus athropaeus

A: Bacillus atrophaeus is a spore-forming bacteria which has now been identified to be an important…

Q: GENE I DNA AGCCTACG C MRNA Amino Acid

A: The correct sequence of mRNA and amino acid name is shown below.

Q: on't copy from Google

A: Let us first discuss the location of each gland and hence it will lead us to the location. Parotid…

Q: Question 2 Describe the colonies as they appear on the Streak Plate. Edit View Insert Format Tools…

A: The streak plating method is used to isolate the single type of bacterial species on a plate. The…

Q: Bacterial techniques, plasmid isolation, digestion and gel electrophoresis

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: Louis Pasteur was

A: Vaccines are a suspension of weakened, killed, or fragmented microorganisms or toxins or of…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: 0000000 0

A: In botany, leaf margins can be described as the boundary or perimeter around the entire leaf edge.…

Q: F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px

A: Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…

Q: ntroduction to a report on the extraction of DNA using the technique of salting out method.

A: DNA molecule is the larger molecule that consists of a chain of nucleotides which was organized in…

Q: Introduction for the forensic PCR lab report.

A: PCR in forensics has many uses. It involves the usage of a technique known as DNA typing or DNA…

Q: Western Blotting

A: Western blotting which is also called as Protein Immunoblotting since antibody is utilized to…

Q: active site

A: Enzymes are proteins, which act as biological catalysts thereby accelerating chemical reactions in…

Q: Rna to Dna

A: RNA to DNA means Reverse transcription:The initial RNA to DNA conversion that runs in the reverse of…

Q: 011. LABEL COW EYE - click on the drawing to edit/add labels.

A: Answer: Introduction: The average radius of the cow eyeball is just over 1/2 inch (15mm) and…

Q: Crime Scene Investigation: Cindy was attacked by a masked assailant but she managed to scratch him…

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: DNA polymerases used in PCR

A: The polymerase chain reaction (PCR) is a method for rapidly producing millions of copies of the…

Q: Sequence morgans experimen

A: According to the question, we have to explain the sequence of Morgan's experiment. So, let us have a…

Q: I need help with determining size fragment

A: Fragment analysis is a genetic analysis approach that consists of a set of processes in which…

Q: To pinpoint a Criminal, Forensic Department uses the technique called? A) DNA Editing B) DNA…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: detailed working of MRI machine .

A: A magnetic resonance imaging (MRI) is a non-invasive procedure that uses magnetic field and radio…

Q: + [Template] SAS4

A: Mutations are changes in the DNA sequence of an organism which may or may not affect its phenotype.

Q: How to AMLIFY dna sequence and CONFIRM its expected size

A: PCR (polymerase chain reaction is a technique through which a DNA segment is copied to a million…

Q: Photo by MJTPanganihan Color: Color: Form:

A: A bacterial colony is a collection of bacteria that all came from the same mother cell. This means…

Q: Genomic islands

A: Genomic islands are regions of large DNA sequences that encode dor accessory genes in a bacteria.…

Q: GENE B DNA ACCCAACA A MRNA Amino Acid

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.

Q: What is the DNA test

A: Deoxyribonucleic acid or DNA is the genetic material in a large variety of living organisms,…

Q: DNA fingerprinting.

A: A genetically modified virus is a virus that has been altered or generated using biotechnology…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.