Snga t

Q: How would Oligotrophic lakes can turn into eutrophic lakes ?

A: Oligotrophic lakes are the ones which have very poor nutrient supply and cannot have much aquatic ve...

Q: according to _______ hypothesis a multicellular organism originated from a coenocytic protist with s...

A: The cellularization (syncytial) theory According to cellularization (syncytial) hypothesis a multice...

Q: Which NUMBER(S) indicate NADH production in the overall process? *

A: Ans- In the given question, the figure represent glycolysis cycle. Glycolysis is a series of reactio...

Q: Which of the following is false concerning the carbon cycle?

A: The carbon cycle is a term used to describe the process by which carbon atoms are constantly transpo...

Q: All members of all species in a certain area is a(an) __________.   a. ecosystem  b. biosphere  c. ...

A: All members of all species in a certain area is a(an) population .   Population is the all members o...

Q: During the citric acid (Krebs) cycle, the energy from acetyl-CoA is captured in which molecules? CHO...

A: Introduction :- Cellular Respiration is the process of oxidation of glucose ( and other energy sourc...

Q: Please select the word from the list that best fits the definition For some people, an insect sting ...

A: some insect like bees, mosquito bite or sting a person when they come in contact with them. the effe...

Q: Use the following figure to indicate the structure that was found to be mutated in the modern day fr...

A: Introduction :- Stickleback is a species of fishes that belongs to family gasterosteidae and the ord...

Q: What happens to individual Vaccinia viral particles that do not possess the genes necessary to overc...

A: As we know that viruses are simple, noncellular entities consist of either DNA or RNA enclosed in a ...

Q: normal wings (A) are dominant to dumpy wings (a) and the presence of eyes (B) is dominant to the ab...

A:

Q: What type of database is OMIM?

A: OMIM (Online Mendelian Inheritance in Man) is a daily updated catalog of human genes and genetic phe...

Q: Which of the following is not an abiotic factor in an ecosystem? A Available light B) Temperature C)...

A: The ecosystem is a community or area where animals, plants and many other elements or organisms live...

Q: What are the characteristics of mate preference in sexual selection?

A: Mate preferences are basically defined as the results of psychological mechanisms that encourage peo...

Q: why is the otter a keystone species?

A: keystone species which means that they can exert top-down pressure via predation on sea urchins and ...

Q: a.) Food quality related the concepts of: b.) Food safety dictates that:

A: a) The food quality explains the food characteristics which are subjective characteristics and objec...

Q: 1.________ errors may be avoided by ensuring that the tools that are used in the experiment are prop...

A: An 'error' is defined as a deviation from accuracy or correctness. A'mistake' is an error caused by ...

Q: 5 joints to describe in the image.  for example her left arm is extended at the shoulder joint.

A:

Q: Given that long wings (L) are dominant to short wings (I), predict the phenotypic ratio in a cross b...

A: Monohybrid cross involves single gene. Because single trait is involved in this case.

Q: charge molecu Some bacterial pathogenic strains have the ability to evade the action does. of antibi...

A: Introduction :- Antibiotics are drugs that are used to treat infections caused by bacteria (bacteria...

Q: 1. Which of the following is the hardest type of coal?

A: Coal is a combustile black or brownish black sedimentary rock. coal is mostly carbon compound with t...

Q: What is the size for cut lane #5 to measure the Sac1?  The T-vector size is 3kb, what is the size f...

A: The DNA is loaded into pre-cast wells in the gel and a current is applied in order to separate the D...

Q: What is a transgene

A:

Q: What does the following vector produce? Be specific.

A: Vector is defined as a DNA molecule which is used as a vehicle to carry foreign genetic material int...

Q: The root of all environmental problems on earth today comes from: A The overpopulation of humans Hab...

A: Our surroundings are always changing. It is a reality that cannot be denied. Nevertheless, as our en...

Q: Cranial nerve blank can be found in the abdominal cavity  what one can be found in the abdominal ca...

A: According to the question, we have to mention the Cranial nerve which can be found in the abdominal ...

Q: Ear shape and eye color are examples of 1. Genotypes 2. Phenotypes 3. Alleles 4. Recessives

A:

Q: zygous Heterozygous Wild Type Female Wild Type Female Male d symbol denotes an gthe phenotype of int...

A: Hemophilia A is inherited in an X-linked recessive pattern. X-linked recessive inheritance refers to...

Q: Which of the following genomes of our biosphere can mutate rapialy? Select one: а. an Oak tree b. Hu...

A: The rate of mutation depends on the number of times an organism reproduces in a specified time perio...

Q: What will be the blood type of the child if it has the following "homozygous" parents for this parti...

A: Prior to the 20th century, it was thought that all blood was identical. This notion led to frequentl...

Q: Modern humans crossed a landbridge from Asia into North America during a glacial period about 20,000...

A: Hominins are primates that belong to family Hominidae. It includes bonobos, chimpanzees and humans. 

Q: Describe the three models for RNAP active-center translocation during transcription initiation?

A: In gene expression. transcription initiation is the first and highly regulated process. In initial s...

Q: Question 23 In fruit flies, eye color is an X-linked trait. Red eyes (XB) are dominant to maroon eye...

A:  

Q: question- What causes bacterial vaginosis and what causes it?  What is the location of the reservoi...

A: Bacterial vaginosis (BV) is an infection of the vagina. With this their is their is change in the no...

Q: The blank is the only bone that doesn't articulate with any other bone

A: The hyoid bone is the only bone in humans that does not articulate with any other bone,but only has ...

Q: CRISPR/Cas9 mediated genome editing has provided an unparalleled means of manipulating the genome. D...

A: CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) is a...

Q: identify some growth and development variables involved in plant growth

A: The growth and development variables involves in plant growth are - Water Light Temperature Nutriti...

Q: Which of the following is NOT a reason why fungi can grow so quickly? Group of answer choices   exte...

A: Fungi are heterotrophs that mostly grow on decaying organic matter. These secrete the digestive enzy...

Q: 11. An autosome is 1. A dominate chromosome 2. A sex chromosome 3. A recessive chromosome 4. Any chr...

A: DNA and RNA are polynucleotides that are composed of a chain of nucleotide monomers with distinct ni...

Q: Create a chromosome map for each set of three genes from the given information. b) the crossover fr...

A: Answers :  X and Z = 8.5% Y and Z = 2.25% Y and X = 6.25% The more lesser the percentage between the...

Q: labeled M is the muscle. A

A:

Q: A young Honduran female patient presented with a huge cutaneous ulcer involving the right shoulder. ...

A: Cutaneous(Skin) ulcers are open sores on the skin mainly due to poor blood flow,pressure or any inju...

Q: Record which pole the dyes traveled to by using a (+) for positive and (-) for negative pole. Hint: ...

A: Staining is a technique in which the substances observed are being made visible to the eyes. In gel ...

Q: What is OMIM?

A: Gregor Mendel introduced the concepts of Mendelian inheritance in 1865 and 1866, which were revived ...

Q: 9. Please determine whether the allele responsible for the trait is dominant or recessive. (A) (B) %...

A: Pedigree analysis gives an idea how the disease is transferred from parents generation to next gener...

Q: Cloned human embryonic stem cells would be useful for which of the following reasons: Group of answe...

A: Introduction :- Cloning is a process of making the genetically identical copies of cell / tissue / o...

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino aci...

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu cuaucccaaaaucua...

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the ...

Q: Scientists look at thousands of mutagenized flies, one at a time, under a microscope. They are looki...

A:

Q: If possible can you can explain what’s going in parts/paragraphs base on this slide, it involves cel...

A: Meiosis is the process through which gametes are produced during cell division. We start with a cell...

Q: Describe the structure of the cell wall of a Gram-negative and a Gram-positive bacterium, respective...

A: A cell wall is a structural layer that surrounds some types of cells immediately outside the cell me...