Sodium hypochlorite (NaOCl, the active ingredient of all bleaches) was dissolved in a solution buffered to pH 6.20. Find the ratio of [OCl-]/[HOCl] in this solution. pKa for hypochloric acid is 53.

Q: Consider the compounds, H5IO6 and H2C3H2O4. a. Write the balanced reactions of each with water. b. ...

A: Answe is below:

Q: Some measurements of the initial rate of a certain reaction are given in the table below. N2|H2 init...

A: The rate of a reaction is proportional to the molar concentration of each of the reactants.  For the...

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

A:

Q: A certain reaction is first order in N, and second order in H,. Use this information to complete the...

A:

Q: The reaction between copper and sulfur is represented by the chemical equation shown below. What is ...

A:

Q: Consider the following system at equilibrium: P(aq) + Q(aq) = 3R(aq) Classify each of the following ...

A:

Q: e pOH of a

A:

Q: How many grams of Cr are there in a sample of Cr that contains 6.84×1023 atoms? grams

A: The amount of chromium present can be calculated as

Q: Which of the following pairs illustrates an ion-dipole interaction? A AICI3 - H20 B none of the choi...

A: The attraction forces between the different molecules are known as intermolecular forces.

Q: Consider the following equilibrium reaction: C= D and Figure 2 to answer the questions below! c. Why...

A: The answer is as follows:  

Q: In each of the following molecules 1-8, identify the relation between the circled hydrogen atoms as ...

A:

Q: What is the final glycosidic link to be broken during glycogen debranching? a-1,3-glycosidic linkage...

A: In glycogen debranching also known as glycogenolysis , glucose is free from glycogen.  Phosphorylase...

Q: Read carefully the given partial names in IUPAC alkane nomenclature and check the columns where they...

A:

Q: HO, HO Refer to the given structure, the -OH substitutions are in, position of each other. A trans B...

A:

Q: Write the ionization constant expression for a 50 mM aniline solution (pKb=9.40 @ 25 C).

A:

Q: 2. What is the mass of KHP that you will weigh? a. The instructions read "Weigh out accurately 700 t...

A: answer :

Q: Thiosulfate ion (S2O32-) and dithionite anion (S2O42-) are teo sulfur containing reducing agents. Wh...

A: Given, Thiosulfate ion (S2O32-) and dithionite anion (S2O42-) are thio sulfur containing reducing ag...

Q: Under certain conditions the rate of this reaction is zero order in dinitrogen monoxide with a rate ...

A: The integrated rate equation for a zero order reaction is,    [ C ]t  = -kt + [ C ]0   [ C ]t   = Co...

Q: ry1 aser - A un kown aas with the percent Composition unkown gas 4.18 Hand 71.7 CI Occupic 244.3.1C ...

A: Since, you have posted a question with multiple sub-parts, as per our company guidelines we are supp...

Q: Magnesium metal reacts with aqueous sulfuric acid solution to produce magnesium sulfate (in solution...

A: an increase in oxidation number means oxidation  a decrease in the oxidation number means the reduct...

Q: Curved arrows are used to illustrate the flow of electrons. Using the provided starting and product ...

A: Organic reactions are those in which organic reactant react to form organic products.

Q: Calculate the concentration equilibrium constant, K’sp for La(IO3)3 in a saturated solution of La(IO...

A: For a sparingly soluble salt, there is a dynamic equilibrium between the dissociated ions and undiss...

Q: Which of the following reactions is correctly balanced? A) CO + O2 → CO2 B) N2 + H → 2NH3 C) 2H2O...

A: Given :-  A) CO + O2 → CO2 B) N2 + H → 2NH3 C) 2H2O + C → CO + 2H2 D) Zn + 2HCl → H2 + ZnCl2  To ide...

Q: What coefficients (in order from left to right) are needed to balance the following chemical equatio...

A: Given, ___Fe2O3(s) + ___C(s) → ___Fe(s) + ___CO(g) Coefficients are needed to balance the above equa...

Q: 31. How many percentage of the radical cation peak of (M +1) will be observed approximately when the...

A: The relative natural abundance of M+1 that is 13C is 1.1% required the relative natural abundance of...

Q: [N:] [H] initial rate of reaction 2.41M 2.25M 0.489M/s 6.14M 2.25M 1.25M/s 2.41M 4.49М 1.95M/s Use t...

A: rate = k [N2]m [H2]n  k = rate constant  m = order of reaction  with respect to N2  n = order of rea...

Q: Is the following, C20,2 CO22, an oxidation or a reduction half-reaction? eTextbook and Media Save fo...

A:

Q: When heated, solid copper(II) carbonate decomposes to solid copper(II) oxide and carbon dioxide gas....

A: According to the Law of conservation of mass " all atoms of different elements must be equal on both...

Q: How many liters of 0.750 M lead (II) nitrate are necessary to react completely with 1.00 L of 2.25 M...

A: Pb(NO3)2 (aq) + 2 NaCl (aq) → PbCl2 (s) + 2 NaNO3 (aq)   Find Moles of NaCl:    Using Formula : Mol...

Q: Which of the following strategies is NOT used in the regulation of glycogen phosphorylase? O phospho...

A: Glycogen is stored at liver,muscle. Phosphorylation converts inactive form to active form. Regulatio...

Q: True or False 1. The camera on a mobile phone can be used as a detector for AAS because it can captu...

A: 1) The camera on a mobile phone can be used as a detector for AAS because it can capture wavelengths...

Q: 1. How many MOLECULES of phosphorus trichloride are present in 4.58 moles of this compound ? molecul...

A:

Q: Chemical Equation for Redox of Copper and Silver Nitrate. Note: Copper has a +2 oxidation number in ...

A:                            Answer  Identify oxidation number of Ag in reactant side Consider the che...

Q: Predict the missing reactant of this biochemical reaction: ATP ADP kinase N. That is, in the drawing...

A: In the given reaction we have to predict the starting material. The starting material is shown below

Q: Which of the following is an example of quantization? None of these are examples of quantization O t...

A:

Q: To treat a burn on his hand, a person decides to place an ice cube on the burned skin. The mass of t...

A: Please find your solution below : Thermochemistry is a branch of chemistry in which we measure the a...

Q: H. ОН PCC .COOH COOH or Na,Cr,0/ OH HNO, or HOAC KMNO, or NaOCI Cyclohexanol bp 161.5°C, den. 0.96 M...

A: The required mechanism is shown below Here initially oxidation of secondary alcohol to a ketone occ...

Q: What is the correct chemical waste of Ammonia and Diethylamine A. Down the sink B. Con...

A: Answer :  

Q: A compound is found to contain 10.37 % phosphorus , 4.689 % nitrogen , and 84.95 % iodine by mass. T...

A: Determination of empirical formula  1)The percentage composition of elements present in given compou...

Q: Which of the following delocalizations will be exhibited by the compound below? OH A sigma electron ...

A:

Q: Part A Consider the reaction: SO2 Cl2 (g) = SO2 (g) + Cl2 (g) A reaction mixture is made containing ...

A:

Q: A certain element consists of two stable isotopes. The first has a mass of 138 amu and a percent nat...

A:

Q: Determine if each molecule below is an aldehyde, ketone or alcohol based on the ending. heptanal 3-m...

A: Alcohol contains R-OH  functional group . Ketone contains R-CO-R functional group. Aldehyde contain ...

Q: In the reaction Zn(s) + Cu2*(aq) Zn2*(aq) + Cu(s), O Cu2*(aq) is the oxidizing agent and Zn(s) is th...

A:

Q: 1. How many MOLES of dinitrogen tetroxide are present in 4.67 grams of this compound ? moles. 2. How...

A: Mole of substance is defined as given mass divided by its molar mass.

Q: Using a curved fish hook arrow, propose a mechanism for the reaction: a) CH3 H3C C=CH2 H3C HBr CH-C-...

A:

Q: 1) Name the ff compounds: 4) 6M -C-CH 2-CH 1) 2) 3) :6:

A: Interpretation- To give the name of the following given compounds which is given as abve inthe quest...

Q: In a gravimetric analysis, we need enough product to weigh accurately. Each tablet provides ~15mg of...

A:

Q: True or False 1. A molecule that is "IR inactive" means that it does not produce any signal due to n...

A: 1 .A molecule that is "IR inactive" means that it does not produce any signal due to no vibration An...

Q: A 225.0 mL sample of 0.10 M Sr(OH)2 is titrated with 0.10 M HI. Determine the pH of the solution aft...

A:

Acid Base Titration

An acid-base titration is the method of quantitative analysis for determining the concentration of an acid and base by exactly neutralizing it with a standard solution of base or acid having known concentration.