1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show its complementary sequence (be sure to show/label the 3'- and 5' ends); (b) Estimate its Tm using the rule of thump method;
Q: difference in volume:
A:
Q: Consider the following Reaction 4 KOH +6KMnO4+10CrCl3+7H2O-->6MnCl2 +5K2Cr2O7+18HCl how many moles...
A: Given :- 4 KOH+6KMnO4+10CrCl3+7H2O→6MnCl2 +5K2Cr2O7+18HCl Number of moles of each reactant = 1 mol...
Q: Give the balanced chemical equation (including phases) that describes the combustion of butene, C4 H...
A: To write the balanced chemical equation (including phases) of combustion of butene.
Q: Some measurements of the initial rate of a certain reaction are given in the table below. H2 2 initi...
A: The sum of the exponent term in the rate law for a chemical reaction is known as the order of the re...
Q: ler certain conditions the rate of this reaction is zero order in hydrogen iodide with a rate consta...
A: Rate Constant,k = 0.0044M/s
Q: A solution has a concentration of 16 ppm. Which of the following is another way to describe the conc...
A: Concentration can be described in different ways. One those ways is ppb ( parts per billion) . ppb i...
Q: Lewis diagram
A: Since you have asked multiparts, we will solve the first three subparts for you. If you want any spe...
Q: Complete the table below for calculating the molar mass of the ionic compound nickel(II) bromide. Nu...
A:
Q: Chemical Equation for Redox of Copper and Silver Nitrate. Note: Copper has a +2 oxidation number in ...
A: Answer Identify oxidation number of Ag in reactant side Consider the che...
Q: Problem 64 C1,H120 MW = 148 Problem 64 - 1H NMR spectrum (CDC13, 50 2H 2H EDC13 1H DC13 ntents
A: 1H-NMR provides the information about the number and types of hydrogens of unknown compound.
Q: Precipitates used in the gravimetric determination of uranium include Na2U2O7 (634.0g/mol), (UO2)2P2...
A: Here the quantity of Uranium is supposed to be constant, then we need to determine which of the comp...
Q: Draw the major and minor product that could be formed when 1-methoxy-1,3-butadiene reacts with 2-met...
A: Diels-Alder reaction: The Diels–Alder reaction is a pericyclic reaction (cycloaddition) between a co...
Q: What is each compounds systematic name?
A: The IUPAC name of the compound can be written on the basis of the number of carbon atoms in the main...
Q: Direction: Solve for the pH or pOH of the following buffer solutions using the Henderson-Hasselbalch...
A:
Q: Write the empirical formula for at least four ionic compounds that could be formed from the followin...
A: The steps to write the empirical formula are shown in the next step
Q: Problem 42 C13H9NO3 Problem 42 - 'H NMR spectrum (CDC13, 500 MHz) MW = 227 2H =, CDC13 2H =, CDCI; 1...
A: NMR spectroscopy measures the effect of external magnetic field on the nuclei and helps in analysis ...
Q: 5) Use a curved arrow notation mechanism to show how each product is formed in the following reactio...
A: Given reaction is : Use the curved arrow notation to show how each product is formed in the followi...
Q: 4) Batholiths have: A- regular forms B- Irregular forms C-Sometime regular forms
A: As per the rules only the first question can be answered.
Q: Draw the lowest energy conformation for the compound shown below. CH 1. Choose a chair from the Temp...
A: Conformational isomers: The conformational isomers are formed by the rotation of a carbon-carbon sin...
Q: Predict the missing reactant of this biochemical reaction: ATP ADP kinase N. That is, in the drawing...
A: In the given reaction we have to predict the starting material. The starting material is shown below
Q: A solution contains 50.0 g of sucrose, C12H22011, a nonelectrolyte, dissolved in 500.0 g of water. W...
A: The formula for the calculation of elevation of boiling point is ∆Tb = Kb * m Where Kb = constant d...
Q: Consider the following reaction 2Al(OH)3+3H2SO4-->Al2(SO4)3+6H2O how many moles of H2O are formed ...
A:
Q: A 0.1500-g sample containing only KCI and CaCl2 produced 0.3254 g of dried AgCl precipitate. Determi...
A: Given that, 0.1500 g of a sample containing only KCl and CaCl2 produced 0.3254 g of dried AgCl preci...
Q: Choose a balanced chemical equation for the reaction of molecular oxygen with beryllium metal to for...
A:
Q: e equilibrium constant, Kp, for the following reaction is 0.497 at 500 K: 디s(g) PCI3(9) + Cl2(g) lcu...
A: Kp is equilibrium constant
Q: 3) Arsenic acid has 3 pK,'s: 2.19, 6.94, and 11.51. Determine the concentrations of all the species ...
A: Since you have asked multiple questions, we will solve the first one for you. For remaining question...
Q: Why does acid rain fall far from the source? Show the equations leading from the combustion of...
A: Interpretation- Tell why does acid rain fall far from the source and show the equation leading from ...
Q: %. The percent by mass of bromine in PNBR2 is (Enter your answer to four significant figures.)
A:
Q: When heated, solid copper(II) carbonate decomposes to solid copper(II) oxide and carbon dioxide gas....
A: According to the Law of conservation of mass " all atoms of different elements must be equal on both...
Q: Consider the compounds, H5IO6 and H2C3H2O4. a. Write the balanced reactions of each with water. b. ...
A: Answe is below:
Q: Problem 20 - IR spectrum Problem 26 100- C;H10,Br MW = 238 80- 60- - CDCI; 40- - CDCI; 20- 3500 3000...
A:
Q: Suppose a 3.00 L scuba tank is filled with about 29.7 moles of air at the ocean surface. If the tank...
A:
Q: In the replacement reaction of magnesium nitrate with tin, how many grams of magnesium would be prod...
A:
Q: At a certain temperature the rate of this reaction is first order in H,CO, with a rate constant of 2...
A:
Q: Balance the following chemical equation (if necessary) for the combustion reaction of propane: C3H8(...
A: In multiple questions we solve only first question according to Bartleby guidelines. Balance the ele...
Q: The molality of a KMNO4 solution is 0.933 at 25°C. What is the mole fraction of potassium permangana...
A:
Q: 2. 1.5 L of 0.117 M NaOH from a commercial reagent that is 50% w/w and a specific gravity of 1.525
A: 2. Given, Specific gravity = 1.525 50% w/w NaOH solution means, 50 g NaOH in 100 g Solution. Mass...
Q: At a certain temperature this reaction follows second-order kinetics with a rate constant of 0.0152M...
A:
Q: Show two possible propagation pathways for a general radical molecule
A:
Q: Silver chloride (AGCI) is a white-gray solid used to treat mercury positioning. A student vacuumed f...
A: The correct option is:
Q: 1. Give a full description (type -purine/pyrimidine- name adenine/guanine/uracil/thymine/cytosine, w...
A: This question is related to biomolecules. Bases are divided in to two categories Purines Pyrimidine
Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...
A: For best buffer solution pH of the solution should be equal to pKa of acid. For effective buffer so...
Q: The pH of pure water at 50°C. is 6.63. At 75°C the pH is 6.35. Compare Kw values at 25°C, 50.°C and...
A: Answer attached below
Q: Two vessels of different shape and sizes are connected by means of a pipe with a valve. Vessel A has...
A:
Q: A o bond arises from the straight-on overlap of two atomic Sigma Bonding orbitals. The electron dens...
A: In PF5, there are a total of 5 sigma bonds all of which are formed by the sp3d hybrid orbitals. This...
Q: At a certain temperature this reaction follows second-order kinetics with a rate constant of 13.2M '...
A:
Q: Unknown compound D has a melting point of 102-3C. Carbon/hydrogen analysis of compound D showed 30.4...
A: Given: Compound I contains 30.4% Carbon nad 2.1% H Conclusion: For every 30.4g of C, moles of C =...
Q: [D] [N] [A] Trial 1 Trial 2 Trial 3 0.1 N 0.1 N 0.1 N 0.1 N HCI 0.1 N HCI 0.1 N HCI NaOH NaOH NaOH F...
A:
Q: The scientific methods is applied to natural phenomena. What is natural phenomena? Give two examples...
A:
Q: er certain conditions the rate of this reaction is zero order in ammonia with a rate constant of 0.0...
A: Rate Constant ,k = 0.0015M/s
Step by step
Solved in 2 steps with 2 images
- A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy). When you ran this protein directly on reversed phase-HPLC with UV monitor set at 280 nm, two peaks were resolved. Mass spec determined that the peaks represented Chain A and Chain B, respectively. The peak area is 500,000 for Peak A (Chain A) and 100,000 for Peak B (Chain B). The molecular masses of Chain A and Chain B are 25,000 and 5000, respectively. The extinction coefficients for Chain A and Chain B are 1 mL/mg.cm and 0.5 mL/mg.cm, respectively. Please calculate x/y.Dr. Alghe has just performed a restriction digest on DNA she extracted from her samples. She must now run her DNA out on a gel to separate the fragments based on size. To do this she must prepare a 1.2% agarose gel, where the percentage is determined as mass/vol. How many grams of agarose must she add to 200 mL of buffer in order to arrive at the correct percentage?Compute for the appropriate amount (mL_) of the compositions of a 10 mL 2x CTAB buffer for DNA extraction. a. 2% w/v CTAB b. 1.4 M sodium chloride c. 100 mM Tris-Cl d. 20 mM EDTA e. 2% polyvinylpyrrolidone MW 40 000
- In order to improve the peptide separation by using a HPLC system, trifluoroacetic acid acts as mobile-phase modifier was added during the preparation of mobile phase. The preparation was performed by a postgraduate student as following:“2.851 g trifluoroacetic acid (MW: 114.02 g/mol) was made up to 500 cm3 in a graduated flask. To this solution, 50 cm3 of ethanol was added, and after mixing the mobile phase was placed in the solvent reservoir and pumping was commenced at 1.5 cm3 min-1.”Based on the given preparation procedure, identify THREE mistakes that were made.Explain the order of elution (with a buffer of pH 4) of the following pairs of amino acids through a column packed with Dowex 50a. aspartate before serine c. valine before leucineb. serine before alanine d. tyrosine before phenylalanineYou obtained the following raw data when setting up a Biuret standard curve: BSA (mg/ml) Absorbancy 540nm 0 0.158 1 0.210 2 0.260 3 0.305 4 0.360 5 0.410 6 0.455 7 0.510 8 0.530 9 0.550 10 0.554 After blanking against a biuret-dH2O sample, the protein concentration of an unknown sample was determined using the same method and an absorbancy of 0.251 was obtained. Set up a standard curve, excluding outliers (experimental and statistical) and determine the protein concentration in the unknown sample in mg / ml (up to 3 significant figures).
- Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.211 and A650=0.086, taking into account the dilution factor as per question 6 (100ul), and the total volume of extract as per question 4 (140ml) . Note your answer to 2 decimal placesYou obtained the following raw data when setting up a Bradford standard curve: BSA (mg/ml) Absorbancy 595nm 0 0.225 1 0.310 2 0.420 3 0.510 4 0.610 5 0.720 6 0.810 7 0.915 8 0.950 9 0.980 10 0.990 After blanking against a bradford-dH2O sample, the protein concentration of an unknown sample was determined using the same method and an absorbancy of 0.523 was obtained. Set up a standard curve, excluding outliers (experimental and statistical) and determine the protein concentration in the unknown sample in mg / ml (up to 3 significant figures).Biuret Assay accurately quantify protein concentration within the range of 5-150 mg/mL. JUSTIFY THE STATEMENT.
- pls explain whyWhat will be the effect on resolution if the ionic strength of the buffer initially used as mobile phase for elution in IEC was too high?a. Increaseb. Decreasec. No effectd. indeterminateIn an SDS-PAGE experiment, protein X has an Rf = 0.75, while protein Y has an Rf = 0.30. Which of the following statements are FALSE during the electrophoretic run?I. X has a greater charge-to-mass ratio than Y, since X has a smaller MW.II. X has a lower MW, and thus experiences less friction with the gel matrix.III. X has more hydrophobic groups, thus is in a more linearized state.IV. X is globular, while protein Y is rod-like, thus X has higher mobility.V. X is affected by less magnitude of electric field because of smaller MW.a. I and Vb. II and IVc. II, III, and IVd. I, III, IV, and VExplain the order of elution (with a buffer of pH 4) of the following pairs of amino acids through a column packed with Dowex 50 a. aspartate before serine c. valine before leucine b. serine before alanine d. tyrosine before phenylalanineI have set up my spreadsheet and was able to reproduce the result with a pKa of 4.64. TRUE OR FALSE