stem-loop For each of the following, identify whether it is an example of primary, secondary, or tertiary structure that might be observed in a nucleic acid (such as DNA). Answers may be used more than once. nucleotide sequence B form supercoiling kinetochore of a yeast chromosome nucleosome secondary structure primary structure secondary structure tertiary structure tertiary structure secondary structure î O () <> (> î

stem-loop For each of the following, identify whether it is an example of primary, secondary, or tertiary structure that might be observed in a nucleic acid (such as DNA). Answers may be used more than once. nucleotide sequence B form supercoiling kinetochore of a yeast chromosome nucleosome secondary structure primary structure secondary structure tertiary structure tertiary structure secondary structure î O () <> (> î

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 4P: Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair...

See similar textbooks

Similar questions

Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
STRUCTURE AND NOMENCLATURE BASE FROM THE PICTURE ANSWER THE FOLLOWING: ( I ALL READY ANWER IT BUT I'M NOT SURE WITH MY ANSWERS, PLEASE CORRECT MY ANSWER IF ITS WRONG. THANK YOU.) Give the ABBREVIATED NAME of the nucleotide in the 5' end. MY ANSWER IS AMP Name the fourth nucleotide from the 3' to 5' end. Use the 2 pointscorrect/appropriate punctuations, spacing and letter case based on thenomenclature. MY ANSWER IS Cytosine-5'-monophosphate What is the total number of hydrogen bonds formed from the complex of 2 pointsthe given structure? Give ONLY the NUMBER. MY ANSWER IS 10 How many 3',5'-Phosphodiester linkages were formed? from the complex 1 point of the given structure? Give ONLY the NUMBER of the linkages. MY ANSWER IS 3 Give the ABBREVIATED NAME of the nucleotide in the 3' end. MY ANSWER IS U Name the first complementary base from the 5' direction. USE ALL 1 pointCAPITAL LETTERS ONLY. MY ANSWER IS ADENOSINE-5'-MONOPHOSPHATE How many terminal phosphate/s is/are present in the…
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.
2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).
Question- Determine the exact molecular weight of the following oligonucleotide and calculate the average molecular weight of an equivalently long oligonucleotide. What is the percent error between the two? Sequence (5’-3’) : GCT TTA GCG GTC AAG TGC TGT GCC ATT T M.W. of a nucleotide in ssDNA = 303.7 + 79.0 M.W. of base pair in dsDNA = 607.4 + 158
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
ISOLATION AND CHARACTERIZATION OF NUCLEIC ACIDS (DNA) State three major differences between the structures of DNA and RNA Give at least two differences between prokaryotic and eukaryotic DNA’s
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).