Answered: Step 1- The Synthesis of…

Step 1- The Synthesis of Dehydrozingerone from Vanillin Step 1 HO Vanillin H + KOH Acetone/H₂O Reflux ALDOL CONDENSATION HO fre Dehydrozingero ne (Vanillid enea ce to ne)

Organic Chemistry

9th Edition

ISBN:9781305080485

Author:John E. McMurry

Publisher:John E. McMurry

Chapter22: Carbonyl Alpha-substitution Reactions

Section22.7: Alkylation Of Enolate Ions

Problem 12P: Why do you suppose ketone halogenations in acidic media are referred to as being acid-catalyzed,...

See similar textbooks

Related questions

Q: Consider the E1 elimination products. Draw the minor product. Br Ꭰ H₂O

A: The major product is the Zaitsev product in which most substituted alkene is formed by eliminatin a…

Q: What volume of 5.00 × 10-3 M HNO3 is needed to titrate 80.00 mL of 5.00 × 10-3 M Ca(OH)2 to the…

A: Reaction involved is 2HNO3 + Ca(OH)2 -> Ca(NO3)2 + 2H2OAccording to reaction 1 mole of Ca(OH)2…

Q: For the aqueous [Hg14] complex K, -6.76 × 1029 at 25 °C. 2+ Suppose equal volumes of 0.0092 M Hg…

Q: None

A: The pentapeptide in question is MGHFD, which stands for:- M: Methionine- G: Glycine- H: Histidine-…

Q: If a 25.0 mL sample of 1.50 M HCL solution were diluted 125-fold, what would be the volume and…

A: Given concentration of HCl (c)= 1.50 MConcentration of new HCl is 125 fold and it is diluted so new…

Q: Write two half-reactions to describe each of these metal displacement reactions. Include phase…

Q: According to the chemists symbolic naming system, what is the name of this molecule? [13:1], A9…

Q: Prepare the compound by using suitable reagents. More than one step will likely be required.

Q: When two molecules collide, which requirements are necessary for a new product to be formed? Select…

A: Step 1: Conditions of collision theory are given below - (i) Molecules must collide with a…

Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…

A: Le Chatelier's principle states that if a dynamic equilibrium is disturbed by changing the…

Q: Complete the electron configuration diagram below for a neutral Sb atom. 7p 6d 5f 7s 65 Increasing…

A: The atomic number of Sb = 51 ( reference:periodic table)Therefore,Number of…

Q: Please Write Step by Step Solution Otherwise I give DISLIKE !!

A: Thank you.

Q: Listen For the equilibrium system represented by 2C(g)+D(g) Elg), the equilibrium constant (Kc) is…

A: To calculate the final (equilibrium) concentrations of C and D, use ICE table to relate quantities…

Q: 3) A chemist tried the following reaction, but did not make the compound she expected. What did she…

A: Let's describe the workings of this surprising product:Mechanism:Formation of Bromonium Ion:Attack…

Q: Calculate the enthalpy of formation of benzene from the following data.2C6H6(g) + 15O2(g) --->…

Q: A solution is prepared that is initially 0.25M in hypochlorous acid (HCIO) and 0.31M in potassium…

A: Step 1: GivenHypochlorous acid, [HClO] = 0.25 MPotassium hypochlorite, [KClO] = 0.31 MpH = ?Ka of…

Q: Name these organic compounds please:

A: All three structures above are alkanes. Alkanes are organic compounds that consist entirely of…

Q: The three normal modes of water are the symmetric stretch (3652 cm¹), the antisymmetric stretch…

A: Step 1: Step 2: Step 3: Step 4:

Q: (SYN) Show how to synthesize each of these alcohols from a ketone or aldehyde that has the same…

Q: Water of Hydration Record the mass empty evaporating dish ( or crucible). Record the mass of dish…

A: Step 1: **Determine the mass of water lost** * Evaporating dish mass = 29.00 g. * The dish mass…

Q: Describe Auger/screw mechanisms and dosator mechanism by which capsules are produced. Use diagrams…

A: Auger/Screw Mechanisms:The auger or screw rotates at a controlled speed to draw the powder or…

Q: 24. Von Franz's work on alchemy focuses on: A) "The symbolic nature of alchemical texts and…

A: A) "The symbolic nature of alchemical texts and practices." is correct because:Marie-Louise von…

Q: = O Kinetics and Equilibrium 2/5 Bi Calculating an equilibrium constant from a heterogeneous…

A: Given: V=8.3Lmass,gMolarmass,g/mol2Hg(l)7.2200.59+O2(g)15.432.00→2HgO(s)11.7216.59Step 1:…

Q: Step-growth, or condensation, polymers are formed from monomers that have more than one functional…

A: Step 1: When hydrazine and oxalyl chloride react in the presence of hexane, they form a polyamide…

Q: Probide a synthetic pathway D O OH HH X

Q: Constants Additional Materials Reading Submit Answer 5. [-/3 Points] DETAILS MY NOTES PREPCHEMCF1…

A: Step 1: Step 2: Step 3: Step 4:

Q: None

A: Here te aldehyde group is more electrophilic compared to the anhydride carbonyl. So the alkyl anion…

Q: Predict the product(s) for each reaction below

A: This are the products for the given reaction. Hope this helps, thank you!

Q: O O HO о 11 Br Н он да Product о Н

Q: None

A: Step 1: Step 2: Step 3: Step 4:

Q: None

A: Part 2: Explanation:Step 1: The starting material, O-Ph (phenol ether), undergoes hydrolysis to…

Q: Calculate enthalpy of the reaction below using Hess' Law. 2CO(g) + O2(g) → 2CO2(g) 4H = ? C(s) +…

A: Step 1:

Q: Please answer the question for the reaction below: + A) B) D) 1) Base 2) 2-Pentenal 3) acidic water…

A: Detailed explanation:The reaction involves base, propenal, and acidic water. The starting aldehyde…

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…

Q: dont provide handwriting solution...

A: Step 1:The given question can be answered by using the Anti-Markovnikov rule or peroxide effect for…

Q: 2. Suggest two sets of conditions that would be needed to form the following cyclic ester (called a…

A: the mechanisms for the formation of tetrahydro-2H-pyran-2-one (lactone) from ethyl…

Q: What changes can be made to the hydrogenation reaction to make it safer for beginner students?

A: Based on the information which you have provided in question, which depicts a step in the transfer…

Q: how to synthesize this? b) NH2

Q: A 25.0 g sample of quartz, which has a specific heat capacity of 0.730 Jgc, is dropped into an…

Q: None

A: a)Step 1 adds nitro group to para position (methyl is an ortho, para director).Step 2 reduces nitro…

Q: 17. What is the Aldol addition product formed from reaction of the following compound with itself? О…

Q: A bubble of methane gas, CH, is released from a deep bog. The temperature at the bottor the bog is…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: 1.3g of copper (II) chloride was dissolved in water and a 0.50g of Al was placed in the solution.…

A: Step 1:Given , Mass of (CuCl2) reacting= 1.3 g Mass of Al reacting = 0.50 g Actual yield of Cu…

Q: If I was in a rush and only let my TLC plate run 1 cm. Am I going to encounter anyissues? If so,…

A: IN SHORT, running a TLC plate for only 1 cm may result in incomplete separation, inaccurate Rf…

Q: H H 6. The relationship between the following structures are CH3 CH3 -OH HO- -H -OH H- -OH CH3 CH3

A: Thank you,Please rate y response.

Q: Give the major elimination product of the following reaction. (CH3)3COK CH3CH2Br ? heat OCH3CH2NH2…

A: Step 1:

Q: 1. Propose a synthesis of alkyl chloride A, using the following alcohol as a starting material.…

A: 1. You can do a substitution of an alcohol to a chlorine in a one step reaction using the reagents…

Q: Step 2 Add curved arrow(s) to draw step 2 of the mechanism. Modify the given drawing of the product…

A: ----------I m sure this will help you I hope you will appreciate my efforts Thank you!!!!!Happy…

Q: 18.3.2 Determining Reaction Orders Some useful physical properties: 1. Polarimetry (optical…

A: Dalton's law of partial pressure:Dalton's law of partial pressure states that total pressure of a…

Q: Give the structures of the cycloadducts formed -SO₂Ph + PhH t. amb. ➤ A + Ph CO₂Me + с CO₂Me Ph B

A: The image shows four sets of reactants undergoing cycloaddition reactions to form products labeled…

Question

In the attached reaction experiment, dur the conversion of vanillin to dehydrozingerone multiple color changes occur. (colorless to yellow to deep red back to yellow) Explain what causes these color shifts. Be sure to include the appropriate chemical structures as part of your answer.

Step 1- The Synthesis of Dehydrozingerone from Vanillin
Step 1
HO
Vanillin
H
+
KOH
Acetone/H₂O
Reflux
ALDOL CONDENSATION
HO
fre
Dehydrozingero ne
(Vanillid enea ce to ne)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

(a) What happens when CH3—O—CH<sub3 is heated with HI?(b) Explain mechanism for hydration of acid catalyzed ethene :CH2 = CH2 + HzO CH3—CH,—OH
give tha three synthesis with mechanism of triazolo(1,5-a) pyridines and 5-triazolo(3,4-b)1,3,4dithiazolo
What products would ypu obtain from reaction of 2,4-dimethyl-2-pentene with BH3, followed by H2O2, OH-? Show its complete reaction mechanism.
please DRAW the full mechanism of the Na2S2O4 reduction reaction below
The (+) - aureol is a natural product that has shown selective activity against certain colon and lung cancer cell lines. It is postulated that a key step in the biosynthesis of this substance is the conversion of carbocation A into B. Propose a possible mechanism for this transformation (MUST show the corresponding arrows).
Virgin coconut oil contains about 46-48% of lauric acid (CH3(CH2)10COOH). In thepresence acid catalyst and an alcohol, propose the mechanism of this reaction.
Can you pls assist me with the mechanism of Benzyl alcohol being oxidised to Benzyl aldehyde and to Benzoic acid using KMnO4 as an oxidant. Showing arrows and everything.
Which reagent(s) sequence(s) is/are optimum for preparing butanoic acid from 1-propanol? i. K2Cr2O7 in acidii. (1) PBr3; (2) NaCN; (3) H2O; (4) [H+] iii. (1) NaCN; (2) H2O; (3) [H+]iv. LiAlH4
Propose a mechanism for the followingreaction.
Using the appropriate reagents and sequence of reactions, propose how you could get 2-Methyl-1,4-pentadiene from Acetaldehyde. Shows the reaction sequence. An important hint, in the synthesis steps you have to performing an oxidation of an -OH to a ketone with CrO3/Pyridine
The Favorskiireaction involves treatment of an a-bromo ketone with base to yield a ring-contracted product. For example, reaction of 2-bromocyclohexanone with aqueous NaOH yields cyclopentanecarboxylic acid.what is the mechanism of the reaction.
Provide the mechansim using curved arrows of the reaction of p-t-butyl phenol treated with acetic anhydride in AlCl3. Include resonance stabilized intermediates and if more than one product is formed, label them as major, minor, etc. thank you for the help