Answered: The 5’ cap is involved in all the…

The 5’ cap is involved in all the following except: Question 19 options: Splicing exons Termination of transcription Translation Transport of the mRNA to the cytoplasm Protein stability

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 7SQ

See similar textbooks

Related questions

Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…

A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…

Q: Tube # 2 3 4 6 5. THE EFFECT OF TEMPERATURE Temp. Abs. 0°C N/A 0°C 25°C 25°C 37°C 37°C 70°C 70°C 10…

A: Changes in temperature can affect the enzyme in different ways. When the temperature of the system…

Q: Create a figure that includes a schematic of the topological map of AlaE. In your topological map,…

A: Topology data from 3 different techniques; hydropathy profile analysis, TMHMM and TOPCONS are…

Q: Describe how the SCAM analysis was performed so that it maintains replicatability.

A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…

Q: Red blood cells synthesize and degrade 2,3-biphosphogylerate (2,3-BPG) as a detour from the…

A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…

Q: Which of the following is true about a mixed type inhibition? a. None of these is true b. A…

A: The enzyme kinetics, inhibition in particular, is vital to understanding and purposefully managing…

Q: Draw the following amino acids linked by peptide bonds: a. aspartate b. lysine c. cysteine d.…

A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…

Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr

A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…

Q: Exercise 10 & 11: Carbohydrate catabolism in general - primarily looking at fermentation paths in…

A: Catabolism and anabolism are two fundamental processes involved in the metabolism of organic…

Q: In the study by Amano et al. the authors developed a collection of RNA sequences that showed optimal…

A: Fibroblast growth factors (FGFs) are a family of signaling molecules crucial for various cellular…

Q: STEM Workplace Practices Q3

A: The objective of the question is to understand the purpose of release-testing in the context of…

Q: What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be…

A: Cholesterol esters are chemical compounds formed by the esterification of cholesterol molecules with…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…

A: The process of protein synthesis is also known as translation. The process of translation is…

Q: Compare and contrast photosynthesis with oxidative phosphorylation.

A: Photosynthesis is the process by which green plants and algae synthesize sugars using the energy…

Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…

A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…

Q: The sugar molecules shown below are a) Enantiomers b) Epimers c) Anomers d) Diastereomers

A: Stereoisomers are defined as molecules that have the same molecular formula and sequence of bonded…

Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…

A: The objective of the question is to understand the effect of obesity on the elimination half-life of…

Q: Draw the structures of Allura Red and the reduced products formed when it had reacted with NADH

A: Allura red is synthetic food coloring, it is a red azo dye that is frequently used in various food…

Q: GQ7

A: The objective of the question is to identify the correct relationship between the two X chromosomes…

Q: draw phosphatidylserine which contains cis-Δ9-hexadecenoate and cis, trans, cis-Δ9, Δ12,…

A: The phosphatidylserine with cis-Δ9-hexadecenoate and cis, trans, cis-Δ9, Δ12, Δ15-octadecatrienoates…

Q: Draw a parallel beta sheet and an antiparallel beta sheet (three strands each). Show the hydrogen…

A: The secondary structure of protein refers to the local folded structure that forms within in…

Q: Binding of a ligand to protein X affects the binding properties of another site on X. This is an…

A: An enzyme is defined as a biological catalyst or simply a molecule that is typically always a…

Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…

A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…

Q: Draw the major organic product of the following reaction. conc. KMnO4, heat

A: Answer is given below Explanation:

Q: Proteases are one of the main drug targets. Choose the False statement regarding proteases. A.…

A: Proteases are a group of enzymes with a catalytic function to hydrolyze ( a reaction where water…

Q: What is the product of CH₂OH H-C-OH HO-C-H H-C-OH H-C-OH CH₂OH COOH H-C-OH HO-C-H I H-C-OH H-C-OH…

A: This is an example of reduction of a sugar with NADH/enzyme. The reaction of glucose with NADH is a…

Q: Genetics 8 Q6

A: The objective of the question is to understand the possible outcomes of non-disjunction during the…

Q: Genetics Question 24

A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…

Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…

A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…

Q: Sketch graphs expected for the Product concentration Vs substrate concentration.

A: Enzymes can be defined as proteins that help to speed up the metabolism. They basically act as…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: The effects of hydroxymethylaspartate as an inhibitor for this enzyme was studied. The following…

A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…

Q: Why can’t we see the double helix structure of DNA of strawberry and kiwi?

A: The question is asking why we can't visually observe the double helix structure of DNA in…

Q: Creatine phosphate is used as a phosphoryl donor for ATP synthesis in muscle. It provides ATP for…

A: a) The enzyme creatine kinase catalyzes the production of creatine phosphate. The response is as…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H H₂N-C -COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: 3. The image below depicts 2,3-bisphosphoglycerate depicted in dark gray, and ß subunits are…

A: The objective of the question is to understand the role of 2,3-bisphosphoglycerate (BPG) in the…

Q: Q5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in…

A: The objective of the first question is to identify a single basepair DNA change that would lead to a…

Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…

A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…

Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…

A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…

Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R2 as…

A: Major elements of biological membranes are phospholipids, which include phosphatidylcholine and its…

Q: 7. Do Km and Vmax get affected by available substrate concentration? Explain.

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Use the figure below to answer which lipid is the most soluble and why? ...

A: Lipids are organic compounds which are polymers of fatty acids that contain a long, non-polar…

Q: The table shows standard reduction potentials, E., for reactions with n transferred electrons.…

A: The objective of this question is to calculate the free energy change, ΔG°, for the reduction of O2…

Q: Blood plasma contains a total carbonate pool (essentially HCO3 and CO₂(d)) of 2.5 x 10-2 M. What…

A: In order to solve this problem, first we need to calculate the initial concentrations of bicarbonate…

Q: Genetics Question 18

A: The question is asking whether the number of chromosomes in the cells produced at the end of meiosis…

Q: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…

A: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…

Q: What is the systematic IUPAC name of the following compound?…

A: for given compound,Option A is correct for systematic IUPAC nomenclature.Explanation:Step 1: In the…

Q: Reverse translate the sequence of insulin pasted…

A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…

Q: drawing of electron pushing not the explaination I just need electron pushing arrow mechanism for…

Q: Question 1: Part a: Graph Y = [I] / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the…

A: Part a:The equation Y = [I] / (Ki + [I]) represents a fractional saturation curve, often used in…

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

The 5’ cap is involved in all the following except:

Question 19 options:

	Splicing exons
	Termination of transcription
	Translation
	Transport of the mRNA to the cytoplasm
	Protein stability

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Define post transcription modifications

VIEW

Step 2: Determine the function of 5’ capping

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
mRNA is produced by ___________. a. replication b. duplication c. transcription d. translation
Which of the following is not directly involved in translation? mRNA RNA Polymerase Ribosomes tRNA Elongation Factors
Which of the following would you expect to have the slowest response in the cell? Protein cleavage Inhibition of translation RNA interference Histone Acetylation
A __________ molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and an anticodon. _____________ molecules are encoded by multiple gene copies in both prokaryotes and eukaryotes, and they catalyze critical reactions functions during translation. Group of answer choices mRNA; rRNA rNA; aminoacyl tRNA synthase tRNA; rRNA rRNA; precursor RNA mRNA; tRNA
Which of the following processes includes the removal of introns in the primary RNA transcripts? Group of answer choices transcription translation post-translational modification post-transcriptional modification
which of the following is not a major factor in regulating specific protein content in the cell? A. Protien lifetime B. Transcription length C. Translation frequency D. Transcription frequency
Which of the following is least likely following translation termination? The polypeptide is released. The mRNA is reused. The ribosome is reused. The polypeptide is immediately active.
Which of the following would you expect to have the fastest response in the cell? Protein Phosphorylation DNA Methylation RNA Splicing Transcription Repressor
Which of the following statements about the translation process is correct? a. RNA is made complimentary to DNA b. A protein is made from the DNA base sequence c. DNA is made complimentary to RNA d. A protein is made from the RNA base sequence
describe a scenario (as you would to a 12th grader) a physiological situation (protein need) that will result at the beginning of the central dogma process (transcription all the way to protein formation)
Which of the following statements regarding the genetic code is false? The genetic code is nearly universal. Each codon codes for only one amino acid. Three different codons function to terminate translation. There is a single initiation codon. Each amino acid is encoded by a single codon.