A __________ molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and an anticodon. _____________ molecules are encoded by multiple gene copies in both prokaryotes and eukaryotes, and they catalyze critical reactions functions during translation. Group of answer choices mRNA; rRNA rNA; aminoacyl tRNA synthase tRNA; rRNA rRNA; precursor RNA mRNA; tRNA

A molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and an anticodon. ___ molecules are encoded by multiple gene copies in both prokaryotes and eukaryotes, and they catalyze critical reactions functions during translation. Group of answer choices mRNA; rRNA rNA; aminoacyl tRNA synthase tRNA; rRNA rRNA; precursor RNA mRNA; tRNA

Name: A __________ molecule is characterized by having a peptide-binding sit
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A __________ molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and an anticodon. _____________ molecules are encoded by multiple gene copies in both prokaryotes and eukaryotes, and they catalyze critical reactions f

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent? Group of answer choices Movement of tRNA from the A site to the P site tRNA binding to the A site Recognition of the stop codon Ribosome small subunit from binding mRNA Movement of the tRNA from the P site to the A site
Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.
Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA mRNA snRNAs miRNAs
A eukaryotic cell has a mutation where the enzyme responsible for creating the 5’ cap for the mRNA is non-functional. Please describe the effect this mutation would have on the cell.
Select all of the factors in the list below that play a role in the translation initiation of eukaryotic cells. the Kozak sequence eIF4G 3'-polyA tail fMet-tRNA the Shine-Dalgarno sequence eIF4E 5'-CAP PolyA Binding Protein (PABP)
Which of the following is an intron and intergenic coded long transcripts, processed into stem and loop structures that may bind specifically or otherwise? a. spliceosome RNA b. LncRNA c. miRNA d. piRNA e. siRNA
Which of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.
The hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC | G Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.
MicroRNAs are small RNA molecules that bind to the 3′ end of mRNA and suppress translation . Some eukaryotic mRNAs have internal ribosome-binding sites downstream of the 5′ cap, where ribosomes normally bind. In one investigation, miRNAs did not suppress translation by ribosomes that had attached to internal ribosomebinding sites (R. S. Pillai et al. 2005. Science 309:1573–1576). What does this finding suggest about how miRNAs suppress translation?
Select the three post-transcriptional modifications often seen in the processing of mRNA in eukaryotes: Group of answer choices heteroduplex formation; base modification; capping 3'-capping; 5'-poly(A) tail addition; splicing 5'-poly(A) tail addition; insertion of introns; capping removal of exons; insertion of introns; capping 5'-capping; 3'-poly(A) tail addition; splicing
MicroRNAs are small RNA molecules that bind to the 3′ end of mRNA and suppress translation . Some eukaryotic mRNAs have internal ribosome-binding sites downstream of the 5′ cap, where ribosomes normally bind. In one investigation, miRNAs did not suppress translation by ribosomes that had attached to internal ribosomebinding sites ). What does this finding suggest about how miRNAs suppress translation?