Answered: The __________ library function returns…

Engineering

Computer Science

The __________ library function returns the sine of an angle.

COMPREHENSIVE MICROSOFT OFFICE 365 EXCE

1st Edition

ISBN:9780357392676

Author:FREUND, Steven

Publisher:FREUND, Steven

Chapter11: User Interfaces, Visual Basic For Applications (vba), And Collaboration Features

Section: Chapter Questions

Problem 10AYK

See similar textbooks

Related questions

Q: I ned help programming this C++ program: Write a C++ console application that calculates and…

A: C++ Code: #include <iostream>using namespace std; float calculateCharges(int hours) { //…

Q: C++ code and find the the output and screenshot of the code. #include #include using…

A: The C++ code is

Q: Write a function named times_ten. The function should accept an argument and display the product of…

A: Given: Write a function named times_ten. The function should accept an argument and display the…

Q: 4- Write a function to find the maximum number of 3 entered numbers VB Net

A: 'VB.Net program to find the largest number 'among three numbers. Module Module1 Sub Main()…

Q: How to convert all the C code to C++(stdio.h) #include using namespace std; int main() { const…

A: #include<iostream>using namespace std;int main(){ const int b=14; const float f=0.20;…

Q: PYTHON PROGRAMMiNG QUESTION ***(im lost and confused)*** convert a date in mm/dd/yyyy format to M…

A: months = ["", "January", "February", "March", "April", "May", "June", "July", "August", "September",…

Q: c) The character \ is called the .. character.

A: This is closing character in HTML.

Q: The function strcat() appends its first argument to its second argument Select one: O True O False

A: given Data

Q: Please help ... C++ Basic Arithmetic You are a cook in a restaurant. You need exactly 3 crabs to…

A: PROGRAM INTRODUCTION: Include the required header files. Start definition of the main function.…

Q: A FLOWCHART

A: Steps to Create: Although it may seem complicated to create a flow flowchart, flow chart maker tools…

Q: Que: Write a function to convert temperature from Fahrenheit to Celsius named “ConvertFtoC” that…

A: Program For the Above Problem #include <stdio.h>void ConvertFtoC(double fahrenheit){double…

Q: odule is a function that contains codes True O False

A: A module is a function or group of similar functions. They are grouped together within a file and…

Q: C programming. Use functions. Code the function named "deci" that printes the largest and…

A: Code: #include <stdio.h>//function definition to find smallest and largest amont 3 decimal…

Q: Department # of Employees Percentage Accounting Marketing XXX XXX XXX XXX Use the following data…

A: - We need to solve the department and employee problem in C.

Q: = Define your function here .f main name input val int(input()) num_dollars, num_quarters,…

A: The main logic for calculation. if user_total<=0: print("no change") return…

Q: When it is 8:00 in Lubbock, • It is 9:00 in New York • It is 14:00 in London • It is 15:00 in Cairo…

A: Required: Python program to calculate time in different cities when time is given in Lubbock city.…

Q: B. Maximum of Two Values Design a function named max that accepts two integer values as arguments…

A: 1) read two numbers 2)call function max and print the return value In max function using if-else…

Q: A(n). statement is a statement that returns a value to the statement that called the function.…

A: Please find the answer below

Q: C Program waite a function that Computes andd keturn X. Function will take values of X and Y as…

A: PROGRAM CODE: #include <stdio.h> // include header file for standard input…

Q: When it is 8:00 in Lubbock, • It is 9:00 in New York • It is 14:00 in London • It is 15:00 in Cairo…

A: NOTE - I have coded using the python programming language. Here I have taken input from the user.…

Q: 2) for both triangle and diamond, first display a triangle of requested size, and then if the choice…

A: #include <bits/stdc++.h> using namespace std; void instructions(){ cout<<"Firstly…

Q: Creates a C++ application that converts military time to standard time (am/pm) using the modulus…

A: Coded using C++.

Q: Function Call Create an algorithm that accepts 3 integers and displays the sum, product and the…

A: The question has been answered in step2

Q: Write the function to print whether number can be divided by 3 on the screen. Print "Can be…

A: Below is the required code in C language. Program Approach: Including necessary header files for…

Q: Falling Distance When an object is falling because of gravity, the following formula can be used to…

A: NOTE - AS per our guidelines we are supposed to answer only one question, please repost other parts…

Q: Use C++ coding Write a program that prints all prime numbers between 2 and 1000 inclusive. Your…

A: #include <iostream> using namespace std; //creating function bool prime(int n){ //this…

Q: #include #include #include double area (double r); // this starts the definition for the area…

A: #include <iostream> #include <math.h> #include <cstdlib> double area (double r);…

Q: Q7: In the function files the output arguments must be typed inside: O Box brackets O Angle brackets…

A: Let us see the answer below,

Q: Q5: Complete the function that calculates the position of an object at any time t> 0. The initial…

A: Input : Given the s0,u0, a, and t. Output : Value of position.

Q: - Falling Distance When an object is falling because of gravity, the following formula can be used…

A: The program will be designed as follows: Define the function fallingDistance(). The function takes…

Q: 3. Intermediate Code The following statement is known: A = - A * (A + B ) - (B – C) / D Plrase make:…

A: The following statement is known:A = - A * (A + B ) - (B – C) / D

Q: ercise 2: Reverse positive numbers Display each positive integer in reverse order of its digits. The…

A: I have provided a c++ program to reverse the given positive numbers.

Q: Home work QI/Create a visual basic program to find the value of the function R from the following…

A: Solution

Q: Request a number from the keyboard. If the entered number is negative, this number is turned into a…

A: logic: Two functions used:- void calculate(int n) and void operation(int n) Here it is:- void…

Q: (Time in Seconds) Write a function that takes the time as three integer arguments (forhours,…

A: Lets see the solution.

Q: (2) jlkäi If you have the following function in Mat lab, the function can be drawn using the…

A: Here, I have to choose the option for the above question.

Q: Prompt the user to enter a 3-letter abbreviation or a day of the week and display the full name of…

A: #include <iostream>#include <string.h>using namespace std;void display(string ); //…

Q: Complete the below function in Python language def checkPassword(pass): #pass must have length…

A: import rep= input("Input your password")x = Truewhile x: if (len(p)>10 and len(p)<15):…

Q: Numbers that are the same as the direction of reading when they are read backwards and straight are…

A: C Code of to find number is palindrome or not is detailed in step 2 with sample output below.

Q: Law of cosines using local functions Write a function named myFunction(xA,yA,xB,yB,xC,yC) which…

A: MATLAB code : % function to calculate length of sides of a trianglefunction l=len(x1,y1,x2,y2)…

Q: This is a set of Alphanumeric characters and Punctuation characters. Control Characters Printable…

A: 1.Alphanumeric characters and punctuation characters Answer: all of the mentioned To find…

Q: Hrite a function named pyramid(s) that takes a string as its input and PRINTS out a pyramid on the…

A: Use a for loop to iterate over the given string Then print it the number of times its position from…

Q: 4. (Prime Numbers) An integer is said to be prime if it is divisible by only 1 and itself. For…

A: Below is the required C++ program: - Approach: - Importing the header file and the namespace.…

Q: (Reversing Digits) Write a function that takes an integer value and returns the number withits…

A: Lets see the solution.

Q: 2. Create a function that will input 10 numbers and will perform the following 1. Display all even…

A: As per the requirement program is developed. Note: Here in the question programming language is not…

Q: ite a function named "sum_from_to" that takes two integer arguments, call them "fi. st", and returns…

A: Lets see the solution.

Q: 3. The factorial n! of a positive number (integer) is defined by n! = n· (n- 1)· (n– 2) . ... 3-…

Q: 2. Complete a program below. The program will read base and height values of a cylinder from the…

A: First declare all the function required and then define it.

Q: flipCase Write a function flipCase that accepts a word as an argument and returns the same word but…

A: See below Step for code and output: Algorithm: open python idle paste below flipcase function in…

Concept explainers

Types of Function

A function is a process or task that does some operation in the program. Some programming languages may contain built-in functions for certain commonly used tasks. Most programming languages also support user-defined functions, which means a user can write their own function to perform some operation. There are some libraries or header files that contain built-in functions for performing certain tasks.

Question

The __________ library function returns the sine of an angle.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
#include <iostream>using namespace std; /* Define your function here */ int main() {/* Type your code here. Your code must call the function. */ return 0;}
3. Intermediate CodeThe following statement is known:A = - A * (A + B ) - (B – C) / DPlrase make: c. Triples
Computer Science R programming Adjust your functions to take into account upper and lower case letters, as well as spaces. Bonus: can your functions also deal with special characters. Apply your first function to the variable x1 and then the second function to your output, so you can convert it back. x1 <- "Hello My Friend" x2 <- "This: Is, Comma: Horror!"
I cant use the sqrt() library function
// LargeSmall.cpp - This program calculates the largest and smallest of three integer values. #include <iostream> using namespace std; int main() { // This is the work done in the housekeeping() function // Declare and initialize variables here int largest; // Largest of the three values int smallest; // Smallest of the three values // Prompt the user to enter 3 integer values // Write assignment, add conditional statements here as appropriate // This is the work done in the endOfJob() function // Output largest and smallest number. cout << "The largest value is " << largest << endl; cout << "The smallest value is " << smallest << endl; return 0; }
USING C++ Please fix the errors in the code (image attached) with the failed test warning (image attached). Thank you! Write a program that removes all non-alphabetic characters from the given input. Ex: If the input is: -Hello, 1 world$! the output is: Helloworld Your program must define and call the following function that takes a string as a parameter and returns the string without any non-alphabetic characters.string RemoveNonAlpha(string userString)
Military to Regular Time Create a function called MilitaryToRegularTime that converts time in the military time format into the regular format. For example, convert 2249 to 10:49 pm. The function should receive a single int parameter that represents the military time. It should return a std::string that contains the regular time counterpart of the given military time. Please see the sample output below to guide the design of your program. Note: Consider possible edge cases in user input to ensure your program works correctly. Sample output: Please enter the time in military time: 1433 The equivalent regular time is: 2:33 pm Make sure that you examine the MilitaryToRegularTime function prototype in time_converter.h, implement it in time_converter.cc, and call it from inside of main.cc. You'll find that skeleton code has already been provided and you simply need to call the function, which can be called from inside main.cc because we include the header file via: #include…
MAKE PSEUDOCODE OR FLOW CHART FOR THIS CODE #include <iostream> int main() { int a,b,c; std::cout<<"Enter value one to interchange: "; std::cin>>a; std::cout<<"Enter value two to interchange: "; std::cin>>b; c=a; a=b; b=c; std::cout<<"After interchange values are: "<<a<<" "<<b; return 0; }
Create a C function that will input 10 numbers and will perform the following 1. Display all even numbers 2. Display all the numbers 3. Display all odd numbers 4. Exit
Flowchart, create. #include <iostream>using namespace std;// Write function declaration here void multiplyNumbers(int, int, int &);int main(){ int num1 = 10; int num2 = 20; int product = 0; // Print value of product before function call cout << "Value of product is: " << product << endl; // Call multiplyNumbers using pass by reference for product multiplyNumbers(num1, num2, product); // Print value of calculated product cout << num1 << " * " << num2 << " is " << product << endl; return 0;} // End of main function// Write multiplyNumbers function here; use pass by reference for result of multiplication. Then use pass by address. void multiplyNumbers(int n1, int n2, int &result) { result = n1*n2;}
c++ Write a function that returns a float value. The function will check the users entry. It will return a float value which is between 0 and 100 and is divisible by 17 If entered value is not a float, display “Error!!! Not a number”. If the number is out of range display “Error!!! Outside the range”. If the number is not between the range, the users will be prompted to enter another number. It will return only a valid number