The activated donor molecule for glycogen synthesis is UDP-glucose. O True O False
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: Consider ten glucose molecules that enter a cell. How many ATP can be generated by the complete…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: There is also another follow up question can you help me with this too please In the second cross, a…
A: A rabbit's coat colour is determined by four alleles: agouti (C), chinchilla (Cch), Himalayan (ch),…
Q: True or False: Passive-mediated transport proteins lower the delta G of transport to create the…
A: Introduction :- The question is all about transport of molecules by diffusion I. e. Active and…
Q: Structure and biological role of phosphatidic acid.
A: The smallest and most basic phospholipid, phosphatidic acid (PA), serves as a precursor for other,…
Q: Please answer the following two questions: 1. Biochemistry and function of chylomicrons 2. The…
A: Chylomicrons are lipoproteins synthesized in the intestine. Lipoproteins are compound lipids…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: Discuss how each denatures protein.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What do all fats have in common? A) they all have identical hydrocarbon chains B) they are acidic C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Fill up the table below to summarize the confirmatory test for casein and whey. Test Sample…
A: Casein and whey are the 2 important classes of proteins in milk. The human milk composition is…
Q: Glucagon is a hormone that indicates low blood glucose. A. Where is glucagon generated and released…
A: Carbohydrates that are obtained through the diet are digested into monosaccharides such as glucose…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: The enzyme lysozyme aid in the breaking down of polysaccharides in the bacterial cell membrane. They…
Q: What structural and functional advantages do proteins gain by associating to form quaternary…
A: In cellular environments, protein interaction networks contain crucial functional modules made up of…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: What explains the observation that FADH2 oxidation yields one less ATP than NADH oxidation by the…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: human cannot digest stachyose. Why？isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: In two of the first three steps of glycolysis: Group of answer choices Phosphorylation reactions…
A: Introduction All living organisms need energy to carry various activities. Once we take food, it…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: Macmillan Learning All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'° for…
A: The value of free energy change helps to determine the spontaneity of a reaction. A positive ∆G…
Q: Classification of lipids.
A: A category of heterogeneous chemical substances that are soluble in non-polar solvents are referred…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: Mechanism of action of electron transport inhibitors. Antimycin A.
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: Protein precipitation was seen in plasma samples that included ethanol solutions above a…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear…
A: Introduction DNA is a self replicating molecule. mRNA is formed from DNA by a process called…
Q: The term that refers to the light-dependent process in plants in which O₂ is consumed and CO₂ is…
A: Plants need energy to perform the functions that keep them alive, just like all other living…
Q: 6. A control phospholipid membrane is isolated in which the phospholipid tails all have an 18-C…
A: Phospholipids are major membrane lipids and present as a bilayer structure. It is consist of…
Q: 1. You order two primers from a company that synthesizes oligonucleotides. The primers have the…
A: Primers are short stretches of nucleotides that are used to initiate the synthesis of nucleic acids.…
Q: High levels of glucose-6-phosphate inhibit glycolysis. If the concentration of glucose-6-phosphate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Just 15-3
A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…
Q: describe the experiment that proved chemiosmotic hypothesis.
A: The chemiosmotic model of ATP synthesis states that ATP synthesis occurs by movement of protons…
Q: Discuss (as comprehensively but as concisely as possible) the role of protein folding in any (one)…
A: Since the question has mentioned to write about any one disease, I’ll write about (c) Cystic…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…
Q: What are ketone bodies and why do they form during fasting?
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Why do we need to determine the extinction coefficient in order to calculate the initial velocity in…
A: Enzyme are proteins that catalyse biochemical reactions. A substrate binds at the active site of the…
Q: Choose all of the true statements about oxidative phosphorylation. Oxidative phosphorylation occurs…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: . Mucic Acid Test for Galactose and Lactose
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…
A: The frequency of recombination is a measure of genetic linkage that is used to create a genetic…
Q: In the presence of saturating amounts of oxaloacetate, the activity of citrate synthase from pig…
A: Citrate synthase is the first and regulatory step the enzyme of citric acid cycle (TCA). Citrate…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: if we are able to recreate or stimulate telomerase, could humans potentially live forever?”
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Step by step
Solved in 2 steps
- The cholesterol synthesized by cells uses which component of the glycolytic pathway as a starting point? a. glucose b. acetyl CoA c. pyruvate d. carbon dioxideWhich molecules can enter the Krebs cycle? chylomicrons acetyl CoA mono glycerides ketone bodiesIn glycogen synthesis , the active form of glucose used is :: A) glucose 6 phosphate B) glucose 1 phosphate C) UDP glucose D) UTP glucose
- In the glycogen synthase reaction, the precursor to glycogen is a. Glucose-1-P b. UDP-glucose c. UTP-glucose d. Glucose-6-PDuring glycogen synthesis in vertebrates, _____ is added to the growing chain by glycogen synthase. Select one: a. glucose 1-phosphate b. UDP-glucose c. ADP-glucose d. glucosewhy are ketones formed during starvation
- The first product formed during glycogenolysis (glycogen degradation at alpha 1,4 glycosidic bonds) is: a. Glucose 6 Phosphate b. UDP-glucose c. Glucose 1 phosphate d. Glucose e. Glucose 1,6 bisphosphateWhich is not involved in the glycogen synthesis? a. glucosidaseb. UDP-glucose pyrophosporylasec. hexokinased. phospoglucomutaseAn allosteric regulator of glycogen synthase is: UDP-glucose. cAMP. glucose 1-phosphate. ATP. glucose 6-phosphate.
- Which one of the following are correctly paired? a. glycogen synthesis: catabolic b. Glycogenolysis: catabolic c. Glycolysis: anabolic d. Gluconeogenesis: catabolic e. TCA cycle: anabolicWhich of the following can be used to synthesize glucose by gluconeogenesis in the liver?a. fatty acidb. triglyceridec. glycerold. glycogene. ATPWhich carbohydrate is NOT produced in the pentose phosphate pathway? glyceraldehyde 3-phosphate erythrose 4-phosphate fructose 6-phosphate fructose 1,6-bisphosphate glucose 6-phosphate
