Answered: The addition of poly(U) is important in…

Name: Give detailed Solution with explanation needed needed (please don't co
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give detailed Solution with explanation needed needed (please don't copy the answer The addition of poly(U) is important inthe degradation of mRNAs encodingwhich of the following proteins: RNApolymerase Histones Myosin Actin

Science

Biology

The addition of poly(U) is important in the degradation of mRNAs encoding which of the following proteins: RNA polymerase Histones Myosin Actin

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 12SQ

See similar textbooks

Similar questions

19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
During DNA replication a mutation occurs that reuskt in the following chnage in the corresponding mRNA sequence: UGG----> UGA. This mutation lies downstream of the start codon. Explain how this mutation would affect translation of polypeptide from this mRNA transcript.
Which of the following peptide sequences is most likely to be found in a hydrophobic pocket of the protein containing it DEAD AVGF ACMN GSYK
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids
The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries the information to make aregion of a polypeptide with the amino acid sequence, methionineglycine-leucine-serine. What would be the consequences if a mutationchanged the second cytosine (C) in this sequence to an adenine (A)?
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for this protein: Phe Ala Met Ser Thr Leu Val
during translation, each codon on the mRNA complementary base pairs with an snticodon on......
For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGA
My PDB code: 3GRS residue point: HIS467 mutation: LEU Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)