Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yes or no 20 Messenger RNA splicing and export are uncoupled processes. Yes or no twenty one Which of the following plays an important role in directing newly synthesized proteins to specific cellular destinations? A. signal sequence b. nuclear localization signal c. chain elongation stretch D. Shine – Dalgarno

Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yes or no 20 Messenger RNA splicing and export are uncoupled processes. Yes or no twenty one Which of the following plays an important role in directing newly synthesized proteins to specific cellular destinations? A. signal sequence b. nuclear localization signal c. chain elongation stretch D. Shine – Dalgarno

Name: 19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends.Yesorno20Messenger RNA splicing and export are uncoupled processes.Yesornotwenty oneWhich of the following plays an important role in directing newly synthesized proteins

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?
In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.
Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
Yet another class of suppressor mutations not described in the chapter are mutations in tRNA genesthat can suppress frameshift mutations. What wouldhave to be true about a tRNA that could suppress aframeshift mutation involving the insertion of a singlebase pair?
In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.
The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point formed during mRNA splicing: the invariant A. its 5â€™-R neighbor, its 3â€™-Y neighbor, and its 2â€™-G neighbor.
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.