The data obtained from the experiment were fit to a single exponential function, which gave kobsd = 7.4 s-1 (shown below). Based on your knowledge of the Klenow fragment mechanism, explain the shape of the curve and reason for the plateau at [14/20* DNA] = 0.38 \ mu M. Note that this experiment was carried out in the absence of a kinetic trap. 14-mer, µM 0.4 0.3 0.2 0.1 0.0 0.0 0.5 1.0 time, s 1.5 2.0

The data obtained from the experiment were fit to a single exponential function, which gave kobsd = 7.4 s-1 (shown below). Based on your knowledge of the Klenow fragment mechanism, explain the shape of the curve and reason for the plateau at [14/20* DNA] = 0.38 \ mu M. Note that this experiment was carried out in the absence of a kinetic trap. 14-mer, µM 0.4 0.3 0.2 0.1 0.0 0.0 0.5 1.0 time, s 1.5 2.0

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
Chargaff’s results yielded a molar ratio of 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T and 1.00 for G to C. Given these values, what are the approximate mole fractions of A, C, G, and T in ox DNA?
Agarose gels with different average pore sizes areneeded to separate DNA molecules of different sizeclasses. For example, optimal separation of 1100 bpand 1200 bp fragments would require a gel with alarger average pore size than optimal separation of8500 bp and 8600 bp fragments. How do you thinkthat scientists prepare gels of different average poresizes? (Hint: Agarose gels are made in a mannersimilar to gelatin desserts such as JELL-O.)
With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.
How many nanograms of DNA should we expect to be contained within the slowest band from the HinDIII-digest of pGLO?
You do a PCR reaction,run a sample of the product on a gel,and use a dye to visualize the bands. Youexpect a single product of 300 bp, whichyou observe, but you also see a band ofabout 550 bp. Can you suggest a reasonwhy? Does the size of the unexpectedband indicate anything about your targetsequence?
This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
During your experiment you analysed only a few of the recombinant clones for the presence of thehighly repeated Alu elements. If you wanted to screen for a single-copy gene, you would need to screenall of a much larger genomic library. Assuming, that you already know the amino acid sequence ofunicorn (a species with a similar physiology to humans) insulin, how would you construct a probe whichwould enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for theinsulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors,enzymes, and DNA sequencers.
Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?