The first base shown in this chromatogram is closest to to : : : : 71 MW Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a the 5'end of DNA b. the 3'end of DNA aSave
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: If a double stranded DNA has 30 percent of cytosine, calculate the percentage of adenine in DNA
A: Introduction: DNA, or deoxyribonucleic acid, is the hereditary material in humans and nearly all…
Q: In 1950, using “blender” experiment, Hershey and Chase demonstrated that DNA, not protein, is the…
A: Hershey and Chase came to the conclusion that the genetic substance was DNA rather than protein.
Q: Sort the size (bp) of DNA fragments on this gel from small to large. 1 smallest and 4 = largest. B
A: Electrophoresis is the method in which the dispersed particles show motion that is related to the…
Q: In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How…
A: Introduction: DNA is made of four nucleotide bases that are adenine (A), thymine (T), guanine (G),…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…
A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…
Q: Refer to the attached DNA model. In the spaces provided on the attached table, identify the…
A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…
Q: A plot showing the % of denaturation as a function of temperature for a melting point of a DNA…
A: DNA is a double stranded helically wound macromolecule. Each strand is made up of a sequence of…
Q: DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis.…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: What allows the peaks to be different colors?
A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: The diagram shown below represents an incomplete section of a DNA molecule. The boxes represent…
A: DNA is a double helical structure that is composed of nucleotides. Each nucleotide consists of a…
Q: Based on what we did in lab, if you have an OD260 reading of 0.006 for a sample of DNA. What would…
A: There are several ways to quantitate solutions of nucleic acids. If the solution is pure, one can…
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…
A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.
Q: suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three…
A: Introduction: Those biomolecules that require in large amount to keep the body fit and healthy are…
Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…
A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…
Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: listed below, match each to the correct definition. Definition a. Unwinds DNA b. Relieves tension in…
A: All these enzymes help and DNA replication. DNA replication process in which exact similar…
Q: Four nucleic-acid samples are analyzed to determine the percentages of nucleotides they contain.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…
A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…
Q: Calculate the concentration of DNA in your purified sample and determine the mass of the purified…
A: More details are needed to determine the mass of purified DNA. So here we providing you the…
Q: If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…
A: Covalent bond is formed by sharing of electrons between adjacent atoms. For example, bond formed…
Q: In a lab question, a student got a DNA solution that has a concentration of 243 ng/uL. The question…
A: Deoxyribonucleic acid (DNA) is the genetic material. It is polymer of nucleotides. Concentration is…
Q: A linear piece of DNA is cut as follows: cut with Ecorl - get 1kb and 4 kb band Cut with Bamhl - get…
A: Ans- According to question For linear DNA – Upon Cutting by for Eco R1 it formed – 1kb and 4kb =…
Q: A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in…
A: Nucleic acids consists of the genetic material which is found in all living organisms. The two most…
Q: A student was analyzing the base composition of a DNA sample, but has lost all the data except the…
A: DNA nucleotide base structure: Each individual unit of the DNA nucleotides is made up of a…
Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…
A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)
Q: of the following DNA models is accurately labeled? a. b. A d. 3'
A: The molecule found inside cells that holds the genetic information necessary for an organism's…
Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…
A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…
Q: What is a DNA Ladder?
A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…
Q: Why evenly spaced sequence in chromatogram is an indication of a good DNA chromatogram?
A: The characteristics of an evenly spaced sequence are:- Evenly-spaced peak, each being…
Q: Place the following stages of a physical mapping study in theirmost logical order:A. Clone large…
A: Artificial chromosome- laboratory constructed cloning vectors that carry larger DNA insert than…
Q: If a DNA molecule has 33 % G, calculate the percentages of A, T, and C. Type the numerical value of…
A: DNA has 4 bases A,T,G and C Together they make up 100% bases in DNA.
Q: Use Chargaffs Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C.…
A: Chargaff observations on the base pairs lead to some rules that help calculate the percentage of…
Q: You are given the following sense DNA sequence:…
A: Solution According to chargaff rule In DNA the Pyrimidine Thymine (T) always pairs with the Purine…
Q: Which of the following is not required for Sanger sequencing of DNA? OA. ddNTPs B. DNTPS C. A DNA…
A: Sanger sequencing is a method of DNA sequencing.It involves selective incorporation of chain…
Q: In this gel, if lane two is DNA from the crime scene, which lane contains DNA from a suspect…
A: DNA fingerprinting method used to find the relationship between the suspect and criminal in the…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: DNA is a double-helix structure that is made up of two intertwined polynucleotide strands that are a…
Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…
A: DNA replication is the process by which cell makes new copies of the DNA molecule.
Q: hy is there a difference between how the DNA looks between a whole food sample (strawberry or peas)…
A: Genes can be found in any food, whether it comes from plants or animals. The majority of the DNA in…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine,…
A: Genome is not a static entity. It is dynamic in nature. It is subject to different types of…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: High quality DNA means that A260/A280 ratio is between 1.8 to 2 whereas a ratio closer to 1.8 is…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandA student was analyzing the base composition of a DNA sample, but has lost all the data except the content of Cytosine, which is 20%. Based on this information, reconstruct the missing data and list the base composition of the DNA sample.I have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step? show the exact process including the volume of water. Indicate if you would use p20,p200,p1000 for each reagant added. you can choose a total volume but cannot be less than 3 uL or exceed 1000uL. Thank you!!
- Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: a. DNA; TACGTTCCAA b. RNA; TACGTTCCAA c. RNA; AACCTTGCAT d. DNA; AACCTTGCATView the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-kCan you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
- Three DNA molecules (DNA1: ATATAT; DNA2: ATCGAT, DNA3: CGCGCG) were separated by DNA denaturation experiment. Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and annotate X and Y axis.Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.