1.5 1.4- 1.3- 1.2- 1.1- 1.0- 70°C 80°C Tm 90°C 100°C FIGURE 10.16 A DNA Melting Curve The absorbance (relative absorbance at 260 nm) rapidly increases as double-stranded DNA denatures (melts). Relative absorbance at 260 nm

1.5 1.4- 1.3- 1.2- 1.1- 1.0- 70°C 80°C Tm 90°C 100°C FIGURE 10.16 A DNA Melting Curve The absorbance (relative absorbance at 260 nm) rapidly increases as double-stranded DNA denatures (melts). Relative absorbance at 260 nm

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: ) *When double-stranded DNA is heated, the two strands separate into single strands in a process…

A: Factors affecting Tm The temperature at which half of the dsDNA is denatured is called T_{m}…

Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: A. 1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…

Q: A260 of a DNA was found to be high. It was not affected by an increase in temperature. Why?…

A: The Absorbance of DNA is observed to show a broad peak at 260 nm. The absorbed double of stranded…

Q: A plot showing the % of denaturation as a function of temperature for a melting point of a DNA…

A: DNA is a double stranded helically wound macromolecule. Each strand is made up of a sequence of…

Q: What allows the peaks to be different colors?

A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…

Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…

A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Chironomus genomic DNA contains approximately 35.5% A. Estimate the percentages of G, C, and T in…

A: The double (ds) stranded DNA duplex structure follows the chargaffs rule, which suggests that the A…

Q: Which of these statements is correct regarding the complimentary sequence to this DNA strand: 5' -…

A: Nucleotide are elemental unit that forms genetic material that is DNA and RNA . It consists of :- I…

Q: DNA ligase

A: The correct option is Option 3. DNA ligase

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: 31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a…

A: ANSWER;-

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage --- A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: Select the incorrect statement w.r.t. double helical structure of DNA. 1. The two chains of DNA run…

A: DNA is the hereditary material and is present in all organisms. It is present in the nucleus and a…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: The ratio of (A+T) to (G+C) in a particular DNA is 1.0. Is this sufficient data to determine…

A: Deoxyribonucleic acid (DNA) is the molecule. that contains the complete genetic code of an organism

Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…

A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…

Q: G-C rich DNA and A-T rich DNA. Which is more prone to errors

A: AT-rich DNA is mostly with condensed chromatin, however GC-rich sequence is located in the dispersed…

Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…

A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…

Q: For the DNA segment 5′ TTGCAC 3′ how many of each of the following are present? nucleotides…

A: Nucleotides are the monomers of nucleic acids, DNA and RNA. A nucleotide is composed of a…

Q: How many subunits does E. Coli DNA polymerase I have? 5 10 1 3

A: The DNA polymerase I helps in replication,repair and recombination of DNA. E.Coli has 5 sub units of…

Q: 1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL…

A: Values given OD 260 = 0.3 A260 of 1.0 = 50µg/ml pure dsDNA Concentration (µg/ml) = A260 reading ×…

Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…

A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by…

A: The DNA (deoxyribonucleic acid) is the hereditary unit. It is a double stranded structure of…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: Base analysis of a plant DNA shows it to have 15 mole percent adenine (moles per 100 moles total…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and…

A: Hi! Thanks for your question. I am answering only the first question, as the image is not given in…

Q: Please help me with the orange question. My answer is leading strand will encounter lagging strand.…

A: DNA replication takes place in a bidirectional mode in which both strands are replicated…

Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…

A: DNA Is a Polynucleotide. DNA is composed of nucleotides strung together to make a long chain called…

Q: These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA…

A: DNA is the type of genetic material present in the organisms like humans and plants. The structure…

Q: The sum of the lengths of DNA fragments 1-3 equal the total original length? True / False

A: Answer : The sum of the lengths of DNA fragments 1-3 equal the total original length : false.

Q: 1 5' AGT C CGAUGC3' 10 8. There are inaccuracies in the DNA molecule shown here. a) Name three…

A: Introduction : DNA is known as deoxyribonucleic acid and the nitrogen bases present in it are…

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: If dhe sequence and directionality of one strand of DNA 1s 5-GCTAG-3', what is the sequence and…

A: DNA stands for deoxyribonucleic acid is composed of two polyneuclotide chains that could around each…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.

A: Noncoding DNA is the part of the DNA that does not code for any proteins. Noncoding DNA accounts for…

Q: The 260/280 ratio of pure DNA is between 1.8- 35 2.0. The absorbance of DNA at different 30…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…

A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…

Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…

A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…

Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…

A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…

Q: A DNA molecule 300 bp long has 20 complete rotations. This DNA molecule is a. positively…

A: If DNA is in the form of a circular molecule, or if the ends are rigidly held so that it forms a…

Q: The phenomenon where double-helical DNA absorbs UV light less than does single-stranded DNA is…

A: UV light absorbed by a double-stranded DNA is less UV light as compared to single-stranded DNA. It…

Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…

A: DNA replication is the process by which cell makes new copies of the DNA molecule.

Q: Name 3 structural features of the DNA and how they help the DNA perform its functions

A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine. These four…

Q: P 10² 10 1 10' 102 10 1o Cot (mole x sec/L) Britten and Kohne showed that once double-stranded DNA…

A: The diagram shown above is the cot curve. It explains the dentauration process. In this process…

Concept explainers

Crime Scene Investigation

A crime scene refers to a place where a crime has occurred. The purpose of crime scene investigation (CSI) is to analyze the complete scene and catch the culprit based on the pieces of evidence collected from the place of crime. The people involved in this process are referred to as crime scene investigators.

Question

In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How would the curve appear if the AT content were increased?

1.5
1.4-
1.3-
1.2-
1.1-
1.0-
70°C
80°C Tm
90°C
100°C
FIGURE 10.16 A DNA Melting Curve The absorbance (relative
absorbance at 260 nm) rapidly increases as double-stranded DNA
denatures (melts).
Relative absorbance at 260 nm

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?
22-71 Indicate whether each of the following statementsinvolving differences between DNA and RNA moleculesis true or false.a. Base pairing occurs in DNA but not in RNA.b. Both DNA and RNA are double-stranded molecules.c. RNA molecules are much larger than DNAmolecules.d. The base T in DNA is replaced by the base A in RNA
The ratio of (A+T) to (G+C) in a particular DNA is 1.0. Is this sufficient data to determine whether the DNA is double-stranded or single-stranded please explain why or why not.
At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).
A circular double-stranded DNA molecule contains 4200 base pairs. In solution, the molecule is in a B-form helix, with about 10.5 base pairs per turn. The DNA circle has 12 superhelical turns. What is its superhelix density σ ?
Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?
CAN YOU PLEASE ANSWER 1b 1a) The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of ~2.14. Normal physiological pH in most cells is 7.0-7.5, which is significantly above the pKa for the phosphate groups, so every phosphate group in the backbone of both strands of a DNA molecule is deprotonated and carries a -1 charge - but DNA in cells is normally double-stranded. Briefly explain, in your own words, why the large negative charges on the backbones of the two strands of a double-stranded DNA molecule don't cause the strands to separate under normal cellular conditions. 1b) If you raise the pH to 12, but keep everything else about the solution in which the double-stranded DNA is dissolved the same, the two strands of DNA will separate/the DNA will denature. Briefly explain, in your own words, why this happens - why does DNA denature at pH 12 but not at pH 7?
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
One gram of cultured human cells contains about 10^9 cells and occupies roughly 1 mL. if the average molecular mass of a base is 660 daltons and each cell contains 6,4 *10^9 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread. Would it be long enough to reach from the Earth to the Moon (385.000 kilometers).
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?