The first two links of the chain of survival include phoning 911 and beginning CPR. Please select the best answer from the choices provided O T O F
Q: the difference between the chemical structures of DNA & RNA and state the said difference in a short…
A: Both the DNA and RNA are made of nucleotides , containing a fivecarbon sugar backbone (pentose) , a…
Q: Statement 1: A genome refers to the complete genetic make-up of an organism. Statement 2: A large…
A: cDNA library is a collection of cloned DNA sequences that are complementary to the mRNA extracted…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that…
A: Introduction:- 1. The first genetically modified organism to be created was a bacterium, in 1973.…
Q: Process involved in producing the genetically modified organism
A: Genetically Modified Organisms can be defined as organisms in which the genetic material has been…
Q: If cells are as old as the organism Question 8 options: the cells are devoid of telomerase…
A: Aging is a natural process in which humans lose physiological and psychological function. The loss…
Q: 1505) Y X ERIELLE X Inbox (1 x $ Tyler SIS X t Dietance X student.masteryconnect.com Classroom G…
A: DNA is made up of nucleotides. the sequence of nucleotides is very important because it dictates the…
Q: Staphylococcus aureus have a gene, mecA, that makes them resistant to the antibiotic methicillin.…
A: Microorganisms are divided into seven types such as bacteria, archaea, protozoa, algae, fungi,…
Q: Please use the below DNAs and complete 4 steps question. Thanks1
A: Replication : It is the biological process of producing two identical replicas of DNA from one…
Q: Choose
A: Introduction :- DNA fingerprinting is a method used to identify an individual from a sample of DNA…
Q: 5. What is Bacteriophage typing?
A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…
Q: Some organisms can live in hot springs. What does this imply about their DNA?
A: Thermophiles(“heat lovers”) are said to be organisms that are able to grow and replicate in…
Q: Since all cells of an organism have same genome they have also same function and structure. Lütfen…
A: Cell is the basic unit of life. According to their number cells can be multicellular and…
Q: Can you please check my answer and make sure it is correct. Question: How can DNA evidence be…
A: DNA can be used to identify criminals with incredible accuracy when biological evidence exists. They…
Q: Some scientists have concluded that this method of gene therapy will be a more effective long-term…
A: Hematopoietic stem cell transplantation (HSCT) involves the intravenous (IV) infusion of autologous…
Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that…
A: CRISPR(clustered regularly interspaced short palindromic repeats)) is DNA sequences found in…
Q: Where would you cleave to generate 2 proteins of equal size? Question 15 options: xi vi…
A: Cleavage of hing region by 2-mercaptoethylamine to generate 2 proteins of equal size of protein…
Q: Please write a paragraph that compares and contrasts transformation, transduction, and conjugation…
A: Transformation, conjugation and transduction are the specialised process in bacteria or prokaryotes…
Q: What is that total minimum editing time? 10/hich followin nntio
A: The minimum time required for editing total 5 manuscripts is - 12 hours. By using following method…
Q: Directions: Answers must be precise and concise. You can use other sources of information related to…
A: Answer
Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…
A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…
Q: Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1.…
A: Genetic engineering is the act of altering genetic material by interfering with genetic processes in…
Q: I need help defining what is DNA Chromatography.
A: Chromatography is known as the most efficient methods that is utilized in purifying as well as…
Q: is DNA replication and Polymerase Chain Reaction the same process? Substantiate your answer in terms…
A: Introduction DNA replication is the biological process of making two identical copies of DNA from…
Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3
A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…
Q: . How did the investigators conclude that the suspect was indeed the murderer?
A: DNA fingerprinting is a technique in which an individual’s DNA is analyzed to identify the pattern…
Q: How will knowledge of recombinant DNA technology be useful to resolve the current challenges and…
A:
Q: a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5…
A: This is the picture of sanger sequencing gel. The first band is the largest one and subsequent bands…
Q: Sample D 10 Kb 9 Kb 8 Kb 7 Kb 6 Kb 5 Kb 4 Kb з кь 2 Kb 1 кЬ 0.5 Kb - Marker N No RE w Xho | | udy n…
A: Restriction enzymes are enzymes that cut DNA at specific sites. Each restriction enzyme recognizes…
Q: Did Wat son and Crick steal Rosalind Franklin's data?
A: Intellectual theft and plagiarism are serious accusations in the academic world. Plagiarism is…
Q: Question 2 The discovery of the DNA structure started the modern era of biotechnology. A True B…
A: Watson and Crick gave the double helix model of DNA. DNA is the molecule which carries hereditary…
Q: Choose 6 persons who you consider had contributed most importantly to genetic science. In short…
A: Gregor Mendel:- The person who laid the foundation of science of genetics. John Abelson:- Discovered…
Q: Which of the following statement is correct about Restriction Enzyme? Question 74 options: A.…
A: Restriction enzymes are used to create cuts in DNA.
Q: Could you please help me with the following questions? I am struggling tremendously. Thanks so much!…
A: It is the spring with water at temperatures substantially higher than the air temperature of the…
Q: The Human genome project used the following methods Shotgun Sanger Both None
A: The Human Genome Project : It was an international effort to find the DNA sequence of the complete…
Q: what is triple code Your answer
A: Genetic code can be described as the ordering of nucleotides in DNA molecules which carries the…
Q: The base sequences of DNA from two different individuals, Alice and Ben, are given below. Indicate…
A: 7. yes the BamHI cuts the dna for Alice and Ben at the same place. 8. for EcoRI, it cannot recognize…
Q: THANK
A: Genetic engineering is the process of using recombinant DNA technology to alter the genetic make up…
Q: In gene cloning, a bacterial cell is used to make several copies of a gene of interest. Which of the…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: What was the inspiration for the CRISPR technology? (The answer will complete the following…
A: CRISPR is a group of DNA sequences present in the genomes of bacteria and archaea, which are…
Q: Select an answer from the dropdown menu: A skin cell is different than a blood cell because Choose…
A: Given: A skin cell is different than a blood cell.
Q: This quarter in lab, you have studied two different technologies that allow genome of a cell:…
A: Scientists have established several methods to edit the genome of a cell. These methods help to make…
Q: a. What are the applications of modern biology in biochemistry? b. What are the implications of…
A: Modern biology is a culmination of physics, chemistry and engineering aspects. This helps us realize…
Q: (AKS 8a2, DOK 1) What are the benefits of using the biotechnology technique shown below? A. В. С. D.
A: Ans: The given image is of resolved DNA bands on an agarose gels. This technique has been…
Q: true or false. if microbe A or microbe B have the whole genome similarity of 68% as determined by…
A: DNA is the genetic material that is responsible for the heredity of the organism. In due course of…
Q: Statement 1: Gene cloning is a process used to obtain many copies of a particular gene or large…
A: Answer : Option (1) is correct. Both statements are true.
Q: Which step is not included in polymerase chain reaction (PCR)? Annealing Extension Transformation…
A: Transformation step is not included in polymerase chain reaction(PCR )
Q: 1. What were the clues that led to the identification of the suspect? 2. What do you think the…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (C0t1/2). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reaction time.Starting with an AA, 2n = 14 genome of Triticum urartu (wild einkorn wheat) and a BB, 2n = 14 genome of Triticum speltoides (wild grass), show a pathway to obtain AABBDD, 2n = 42 Triticum spelta (spelt wheat) that is commonly used in cereals, pasta, and bread. Show your work for full creditconsider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
- What does RFLP stand forThis answer is copied, a sign of plagarism, I need a explanation not from the internetConsider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was subjected to pyrosequencing, sketch the expected profile of the sequencing output. Assume that the sequential flooding of nucleotides follows the order G-C-A-T.
- Please help me identify 1 and 2. Answer Choices for 1: • DNA • Products • Substrates Answer Choices for 2: • Intermediate • Product • SubstrateQUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. ImmunocytochemistryComputate bioinformatically the Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the selected gene. Please provide also the tool source of the computation. Sickle Cell Anemia is the disease being used. Please answer the question using sickle cell anemia
- Refer to the sequence below to answer the following questions. 5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’ 3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’ Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’Describe the function of the following reagents used in the DNA extraction procedure?a) Proteinase K b) 5M Nacl c) Isopropanol d) 1X TE Buffer