This quarter in lab, you have studied two different technologies that allow genome of a cell: transformation and CRISPR. In your own words, briefly c differences between these technologies. (For example, these can be differences between their outcomes, procedure something else.) Please respond in 2-4 sentences.
Q: Because strawberries have 8 sets of chromosomes, they yield a lot more DNA compared to that of cheek…
A: DNA is a lengthy molecule with two spirals winding around each other in the shape of a double helix.…
Q: CRISPR AS9 is a: alien weapon to control our minds a eukaryotic gene protein matrix type of immune…
A: What is CRISPR-CAS9 It is a unique technology that helps in the editing of different parts of…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: You are asked to participate in a clinical trial for a new drug that can activate telomerase. Cancer…
A: Cancer The unlimited, abnormal division of cell is known as cancer. In cancer the cell is divide…
Q: If cells are as old as the organism Question 8 options: the cells are devoid of telomerase…
A: Aging is a natural process in which humans lose physiological and psychological function. The loss…
Q: Proto-oncogenes and oncogenes are often misunderstood. Briefly describe the relationship between…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Decoding a DNA Message 2. AAT CTC CGA GCT TTG TAG TTA CCC ATT TAG AGT ATC TAG TTG TGT CTC GCT CTC…
A: DNA is a deoxyribose nucleic acid. It is the genetic material of the body and presents mainly inside…
Q: Staphylococcus aureus have a gene, mecA, that makes them resistant to the antibiotic methicillin.…
A: Microorganisms are divided into seven types such as bacteria, archaea, protozoa, algae, fungi,…
Q: MORE GENETIC TIPS 1.RNA was isolated from four different cell types and probed with labeled DNA…
A: The isolation and characterization of a gene is possible due to the advent of molecular clonic…
Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…
A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…
Q: 5. What is Bacteriophage typing?
A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…
Q: Which of the following is a transversion mutation Select 4 correct answer(s) OA --> T OC--> T C -->…
A: Point mutations The mutations that occur at single base nucleotides are called a base or point…
Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You
A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…
Q: Choose the one answer that fits best. Read carefully. Which of the following statements about the…
A: Option C is not correct-The plasmid used for transformation is called E.coli
Q: select all correct answers Which of the following statements about genes are correct? A gene is a…
A: DNA is the component of genes. Some genes serve as blueprints for the synthesis of proteins. Several…
Q: mutagenesis using degenerate
A: 5. Random mutagenesis can also be accomplished by the insertion or deletion of nucleotides from a…
Q: • Direction: Research and write your opinion about one or two Controversies and Ethical Issues…
A: Genetic engineering- the process of using recombinant DNA technology to alter the genetic makeup…
Q: What conclusion would you draw if the numbers of bacterial colonies in Figure 18.22 were the same on…
A: Mutations are described as any change in the genetic sequence of an individual. The substances that…
Q: Please write a paragraph that compares and contrasts transformation, transduction, and conjugation…
A: Transformation, conjugation and transduction are the specialised process in bacteria or prokaryotes…
Q: 3. In harvesting pharmaceutical products, such as human insulin and growth factor, from bacterial…
A: It is the process of using recombinant DNA technology to alter the genetic makeup of an organism.
Q: somatic cells and CRISPR Cas9
A: Cells are the littlest units of life, and subsequently are regularly alluded to as the "building…
Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…
A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…
Q: Write the term or phrase that best completes each statement. Use these choices: gel electrophoresis…
A: PCR is biochemical research technique developed in 1985 by Kary Mullins. It is based on the…
Q: Genomic and cDNA libraries are DNA libraries. True False
A: A Gene library is a collection of different DNA sequences from an organism and it is also known as a…
Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…
A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…
Q: The southern blot below is the results of a PCR-based paternity test conducted at KNUST forensic lab…
A: The genetic material of an individual is packed in the form of DNA. Shorter nucleotide sequences…
Q: is DNA replication and Polymerase Chain Reaction the same process? Substantiate your answer in terms…
A: Introduction DNA replication is the biological process of making two identical copies of DNA from…
Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…
A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…
Q: Select all true statements regarding CRISPR: A. CRISPR stands for Clustered regularly interspaced…
A: Genome editing refers to a set of techniques that enable scientists to alter an organism's DNA.…
Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Part 2: Answer the questions below to indicate how the recombinant DHFR fusion protein wilI be…
A: coli RNA polymerase, directs the expression of the dhfr gene cloned into the plasmid.
Q: Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding…
A: Introduction:
Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…
A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…
Q: THANK
A: Genetic engineering is the process of using recombinant DNA technology to alter the genetic make up…
Q: . The website CBioPortal (http://www.cbioportal.org)is an exceptionally useful program for…
A: Oncogene is a gene that is responsible for causing cancer. Tumor-suppressor genes are normal genes…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The…
A: The complicated process of DNA replication necessitates precise coordination between numerous…
Q: In gene cloning, a bacterial cell is used to make several copies of a gene of interest. Which of the…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: What was the inspiration for the CRISPR technology? (The answer will complete the following…
A: CRISPR is a group of DNA sequences present in the genomes of bacteria and archaea, which are…
Q: Select an answer from the dropdown menu: A skin cell is different than a blood cell because Choose…
A: Given: A skin cell is different than a blood cell.
Q: Please answer part 1A and 1B please I will upvote then with a proper explanation for the correct…
A: Micro satellites are short short DNA segments usually 1 to 6 base pairs that is repeated multiple…
Q: Statement 1: Gene cloning is a process used to obtain many copies of a particular gene or large…
A: Answer : Option (1) is correct. Both statements are true.
Q: 5' 3' C Process 1 5° Process 2 5 3'
A: Introduction Transcription:- Synthesis of mRNA from DNA template - Transcription is the process by…
Q: gene Genetically Engineered Virus Chromosomes Bone manow Figure 15-2 A normal hemoglobin gene is…
A: Dna finger printing is a technique which is used to compare the DNA of two individuals to identify…
Q: What type of replication must be occurring?
A: The above mentioned experiment resembles the Meselson–Stahl experiment that demonstrates the three…
Q: a. Genome Project-write b. Mitochondrial DNA 'Spring Cleaning' c. Micro-encapsulation с. d. Specific…
A:
Q: You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA…
A: The correct answer is option b. Deoxyribonucleic acid helix is made up of four nitrogenous bases,…
Q: Genomic and CDNA libraries are DNA libraries. True False
A: DNA libraries is a collection of DNA fragments .There are various type of DNA libraries example -…
Q: PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base…
A: A base pair is a basic unit of double-stranded nucleic acids, consisting of two nucleobases linked…
Step by step
Solved in 2 steps with 1 images
- In the "Bacterial Transformation" experiment, why were there no fluorescence bacteria present in the other plates even though these were inserted by the +pGLO plasmid? (Note: Discuss the importance on the addition of ampicillin and arabinose to the medium of the genetically engineered bacteria). Limit your answer to 1-3 sentences only.The search for the BRCA1 breast cancer gene discussed in this chapter was widely publicized in the media (for example, Newsweek, December 6, 1993). Describe the steps taken by Mary-Claire King and her colleagues to clone this gene. How long did this process take?. The website CBioPortal (http://www.cbioportal.org)is an exceptionally useful program for visualizing thecancer genes and genomes of tumors from thousandsof patients with different kinds of cancer that havebeen analyzed by whole genome sequencing and insome cases, by RNA-Seq.Go the the CBioPortal site and click All underSelect Cancer Study and in Enter Gene Set typePTEN, then hit Submit. On the page that is returnedyou will see how the coding region of the PTEN geneis altered in tumors investigated in the various studies.Hitting the tab Mutations will let you see the detailsof these mutations relative to the PTEN protein, whilethe tab Expression lets you see how the gene’s expression (in terms of cDNA reads) is altered in individual tumor samples.a. Is PTEN an oncogene or a tumor suppressor gene?What kinds of evidence lead you to this conclusion?b. What kinds of cancer are most likely to involvealterations of PTEN?c. How would you identify patients whose tumorcells are particularly…
- please answer these questions for this image What is the source of the DNA? What is the target? What vector is being used to move the DNA? What is the benefit of transforming the target cell in these ways?Give only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein 2_nucleotide sequence, Amino acid sequence, and primers are obtained. 3_PCR protocol already described 4_bp has been calculations and estimated agarose gel image already designed. Questions: How do you analyze whether your target protein is expressed by E. coli cells. Explain your analysis method in detail and give information about the results you expect (in detail please)Please help me answer topic is about making a recombinant DNA model
- please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenwill be focusing on genetics as a whole, but also differentiating some specifics for bacterial genetics. The area where I want you to focus for this discussion is on a gene in a microorganism that provides a characteristic you find interesting. However, I want it to be a gene that is beneficial for the microbial cell, but allows for a negative impact related to the human. For example, some strains of Staphylococcus aureus have a gene, mecA, that makes them resistant to the antibiotic methicillin. They are commonly called methicillin-resistant S. aureus or MRSA. The gene is beneficial to the bacteria because it allows for their survival even in the presence of this antibiotic but is negative for humans because it limits what antibiotics can be used for treatment. There are a large range of options here including microbe structures as well as the production of various substances so don’t limit your search.Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
- answer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)Hi, can you tell me which gene(s) are being mutated in humans due to hepatic exposure to high levels of PCB toxin? Thanks!!#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: