The following are sequences from three different alpha helices found in human proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b) mostly hydrophilic, or c) amphipathic. Use the helical wheel to explain your answers. Given the character of these helices, in which part of the protein would you expect them to reside?

The following are sequences from three different alpha helices found in human proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b) mostly hydrophilic, or c) amphipathic. Use the helical wheel to explain your answers. Given the character of these helices, in which part of the protein would you expect them to reside?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solution
If a new isolated protein called STICKY and this STICKY protein contains a bHLH domain. Now, how we predict the function of STICKY and the rationale for the importance of these domains in the STICKY function?
using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?
What drives spontaneous folding into the correct tertiary structure for a newly synthesized protein?
Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?
To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an amino acid is 120. • How many amino acids are present in this hypothetical protein? • What is the minimum number of codons present in the mRNA that codes for this protein? • What is the minimum number of nucleotides needed to code for this protein?
What structural problems do cross-links "solve" in small domains like the zinc finger and disulfide-containing toxins?