Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solution
Q: B. Enumerate all the possible DNA nucleotide base sequence for the amino acids given. 4. Met – Leu –…
A: Proteins are polypeptide sequences that are comprised of amino acids. Amino acids are linked…
Q: Write a reaction sequence showing why RNA is more susceptible to nucleophilic attack than DNA
A: One of the differences between RNA and DNA is the sugar that they contain. The DNA has a deoxyribose…
Q: If FEWPRQVDMARINE chymotrypsin, what will the products be? a. F EW PRQVMARINE b. FE WPRQVD MARINE c.…
A: Given : Protein : FEWPRQVDMARINE sequence
Q: Lead Acetate Reaction To 1 mL of the sample in a test tube add 1 mL of 40% NaOH. Boil the content…
A: Lead Acetate test: It is used to detect sulfur containing amino acids cysteine (S-S group) and…
Q: C
A: This question can only be answered hypothetically by taking the standard Rf values of some polar…
Q: Why are protein samples denatured before running SDS PAGE? A. To allow separation based on charged…
A: Denaturing a protein means unfold the protein and make the protein lose its 3D structure. In…
Q: Draw the structure of each dinucleotide and identify the 5 'and 3 ' ends. a. the deoxyribonucleotide…
A: Dinucleotide is formed when two nucleotide gets bind together. 5' end of one nucleotide attaches to…
Q: Define the following terms:a. Rieske proteinb. Psa dimerc. D1/D2 dimerd. A0e. A1
A: The biological system can be defined as a system or the group of entities, organs that will work…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…
Q: What do you mean by algin? Give example.
A: Cholesterol: It is a type of lipid that is insoluble in water. It is a type of fat and it is…
Q: Is RNA-binding enzyme RNase A more likely to have a pI of 9.2 or 5.0?Briefly explain your reasoning.
A: Ribonuclease A (RNase A) is a digestive enzyme secreted by the pancreas that specifically digests or…
Q: (a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the…
A: In the biological system, there are several metabolic reactions that occur that result in the…
Q: Which best describes the fate of this protein?
A: The correct answer to this question is: The protein remains in the cytosol
Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2…
A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino…
Q: what does this suggest. b) suggest a macromolecule where this modification might occur
A:
Q: Deoxyribonucleotides a) Lack a hydroxyl group at position 2 of the sugar molecule b) Lack a…
A: Nucleotides are composed of nitrogenous base, a pentose sugar and a phosphate. DNA contains…
Q: Based on the given blosum matrix, which 2 amino acid would most likely be found in place of val? Why…
A: SCORING MATRICES: In an alignment, a scoring system is a collection of values used to validate the…
Q: What is the significance of the red blood cell being anucleate (without a nucleus)? Did it ever have…
A: Blood is the chief fluid in the circulatory system and comprises of following elements :- A ) Red…
Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids.…
A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic…
Q: If the DNA gene is TAC GGT TTA CAG, which amino acids will be put together?
A:
Q: Does the oxygen in the newly made ester bond come from the phosphate or from the sugar?
A: Step 1 Esters are a functional group which is characterized by a carbon bound to three other atoms:…
Q: Five amino acids were subjected to normal phase chromatography, and the folkowing Rf val were…
A: Chromatography is the technique of separation of components of a mixture based on their physical…
Q: Which statement is FALSE regarding when a pyrimidire base is incorporated into a deoxynucleoside?…
A: DNA ( deoxyribonucleic acid) is a type of nucleic acid. Nucleic acids are present inside the…
Q: Draw the molecule. B-D-Gal(1 → 3)ß-D-GlycNAc Ta(1 →2) L-Fuc
A: Fucose has the chemical composition C6H12O5 and is a hexose deoxy sugar. It is located on the…
Q: The antibiotic cordycepin inhibits bacterial RNA synthesis. Solve, (a) Of which nucleoside is…
A: Cordycepin is an antibiotic, which also acts as an anti-inflammatory compound as well as…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: What is the isoelectric point of this fragment? DHVTHLRKMG
A: Here the given peptide is: DHVTHLRKMG…
Q: The anomer of a-D-gluсоруranose IS CH2OH он ÓH он CH:OH он он он он CH,OH он он
A: Glucose is the primary source of energy for humans and other organisms as well. Glucose contain four…
Q: Novel antiviral agents isolated from Caribbean sponges led to the development of vidarabine, the…
A: Due to the increasing viral infections, scientists have discovered some new drugs, having a…
Q: Define the following terms: a. oligonucleotide b. nuclease c. phosphodiesterase d. nucleosidase e.…
A: The genetic material, DNA that transfers the genetic information from one generation to another by…
Q: Explain what is happening in point A in terms of the form of Alanine. What is point B? Explain what…
A: Alanine is an Amino acid which consists of 2 acidic groups. Hence it is considered as diprotic Amino…
Q: 25) Although the UV280 extinction coefficient of BSA is well known, why was the BCA assay employed…
A: Protein assays normally used to standards to quantify quality of other protein, by comparing unknown…
Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…
A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The…
Q: . Why is it important to eat food containing antioxidants? Write at least two reactions to prove the…
A: Note: Since you have asked multiple question, we will solve first question for you. To get remaining…
Q: what is the n-terminal AA residue? use one-letter code for amino acid
A: The N-terminal amino acid residue is the amino acid that is present in the N-terminal. For protein…
Q: Write a DNA sequence that would encode the amino acid sequence…
A: In DNA, the hereditary information is contained within the nucleotides called codons that correspond…
Q: Identify the amino acids present in the structure from N terminal to C terminal. (answer in lower…
A: Amino acids are building blocks of proteins, It is organic molecule and compose of carbon, hydrogen,…
Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln
A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…
Q: Draw a peptide with 2 or 3 amino acids from the name Emily
A: Peptides are formed by the joining of the amino acids by the removal of water via the condensation…
Q: (a) Are α -glucose and β-glucose enantiomers? (b) Show thecondensation of two glucose molecules to…
A: Glucose is a six-carbon compound. It is abundant in nature. It is synthesized by plants. It is the…
Q: How many cysteines are present in the amino acid sequence you were given? A.45 B.12 C.60 D.10…
A: Cyteines are one of the 20 amino acids which are ribosomally incorporated into proteins. This amino…
Q: What are pentoses? What are the roles of pentoses in DNA and RNA molecules
A: Carbohydrates are the biomolecules which is composed of monosaccharide, disaccharides and…
Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…
A: The genetic code is a system of principles that live cells employ to convert data contained in…
Q: Can you hypothesize why a mixtureof (Poly U)+(Poly A) would not stimulate incorporation…
A: The copolymer experiment was developed in the 1960s by Gobind Khorana who chemically synthesize long…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Proteins or peptides are a linear chain of amino acids attached together via peptide bonds. Natural…
Q: |Three amino acids, alanine, arginine and aspartic acid were separated by electrophoresis at pH= 5.…
A: The pKa values of amino acids correspond to the ionizable groups of the amino acid. If the pH of the…
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH?
a. dark violet solution
b. light violet solution
c. blue solution
d. colorless solution
Step by step
Solved in 2 steps
- With, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4? Please explain how you find this out. Thanks!Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-GlnA) Can you please tell me which of these A.A have a negative side chain? Names of choices in picture provided. B) Can you please tell me which A.A have a hydrophobic side chain and why? Names and choices in picture provided. Thank You so much!!
- What is the isoelectric point of this fragment? DHVTHLRKMGa. Why is it important to eat food containing antioxidants? Write at leasttwo reactions to prove the answer. b. Write in four ways the following nucleotide sequence: ATGCA. c. Explain i. Hoogsteen pairing & ii. Hyperchromic effectiii. Epimers Iv. Mutarotaton v. Aldose vi. Anomers vii. MutarotationWrite out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
- The oligonucleotide d-ATGCCTGACT was subjected to sequencing by Sanger’s dideoxy method, and the products were analyzed by electrophoresis on a polyacrylamide. Draw a diagram of the gel banding pattern obtained.Please help! Sketch a titration curve of the peptide Ala-Tyr-Gln-Met-Asp-His from pH=0 to 14 up to 5 equivalnets of KOH (Please type answer)In analyzing the base composition of a DNA sample, a student loses the information on pyrimidine content. The purine content is A = 27% and G = 23%. Using Chargaffs rule, reconstruct the missing data and list the base composition of the DNA sample.
- why is CH3-CH-CH2-CH2-CH3 non imposable ? I OHThe bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.Based on the given blosum matrix, which 2 amino acid would most likely be found in place of val? Why does this happen, explain.
