The following population, C, has no limits on food resources or space: Population size = 500 • Births = 240 %3D Deaths = 170 %3D How many individuals will be in the population at the start of the second generat

Q: Why did it take so long for scientists to figure out that infections are caused by bacteria? What we...

A: Bacteria is prokaryotic microorganism. 

Q: How would you explain the importance of tropicalrain forests (Core Case Study) to people who thinkth...

A: Rainforests are home to some of the world's most significant trees. Rainforests are classified into ...

Q: Chose an enzyme important in viral replication you want to target (examples: DNA polymerase, reverse...

A: Viruses are different from other microorganisms. They are obligate parasites and are only infectious...

Q: What are the two key concepts for this section?Define freshwater. Explain why access to water is ahe...

A: Water is a vital resource that is essential for human survival, health, and economy. Access to clean...

Q: DNA evidence

A: DNA = Deoxyribonucleic Acid .

Q: Which of the following statement is correct? a. In insertion mutation, an organic compound insert i...

A: Alternation of DNA sequence takes place in mutation which results in change in genotype and phenotyp...

Q: widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her brother both have a ...

A: Introduction:- A Punnett square is a representation of how different gametes combine to produce dis...

Q: A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data pr...

A: Phylogenetic tree / evolutionary tree is tree that evaluates the relationship of various taxa with e...

Q: bioinformatics help scientists understand the diversity of proteins?

A: Solution : Bioinformatics uses computer programs for a variety of applications, including determinin...

Q: List three general uses for industrial fermentation ethanol.

A: On an industrial scale, ethanol is produced by the fermentation of molasses. Molasses is the mother ...

Q: 94. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA polymeras...

A: DNA polymerase is typically used in the DNA replication process.  Beta DNA polymerase is a subtype t...

Q: What is the key concept for this section? What isHIPPCO? What is the greatest threat to wild species...

A: Ecology is the study of how living organisms, such as people, interact with their surroundings. Huma...

Q: Explain how fog forms off the San Francisco coast. For a complete answer, you need to use the follow...

A: The term fog is associated with the cloud that is comparatively closed to ground than to the sky. Fo...

Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the...

A: Solution : correct option is C

Q: Do all cells contain DNA? Explain your answer.

A:

Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...

A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...

Q: 3. How can one use a pedigree chart to hypothesise how a certain condition is transmitted? Can a ped...

A: Pedigree shows relationship between family members and indicates which individual have certain genet...

Q: Are all vertebrate animals capable of producing a concentrated urine like you are? Why or why not?

A: No Though vertebrates produce wastes that are qualitatively similar to those produced by higher inve...

Q: Tabulate the results of your two-point threshold experiment and produce the homunculus.

A: Answer 

Q: Patients, who have a defect in one of the DNA repair systems may have what? Check All That Apply A....

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA rep...

Q: What happens if the body's cellular respiration system malfunctions? Explain your answer

A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...

Q: Can someone please explain the distinction of natural selection and evolution of populations?

A: Answer 

Q: Unlike most examples of this trait, the height characteristic that Mendel studied in pea plants exhi...

A: Mendel's experiment Mendel studied the seven contrasting characteristics of pea plants. These traits...

Q: The Calvin cycle in CAM photosynthesis occurs in O bundle sheath cells. O xylem cells. O mesophyll c...

A: The calvin cycle in CAM photosynthesis occurs in mesophyll cells 

Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху In human, each cell has how many chromosomes...

A: The cell division is the process that involves breakdown of the mother cell and produce two or more ...

Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?

A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: Define natural capital. Define natural resourcesand ecosystem services, and give two examples ofeach...

A: "ANSWER  Natural capital refers to natural assets that provide natural resource inputs and environm...

Q: Question: Discuss the significance of doing water bacteriology on drinking water from the community.

A: Q. Discuss the significance of doing water bacteriology on drinking water from the community.      A...

Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...

A: Humans are either left-brained or right-brained, according to this notion, implying that one half of...

Q: Liverworts were given their name based on this flat, lobed leaf-like structure

A: Liverworts is a flowerless spore producing plant.  English word 'wort ' means "small plant " . The t...

Q: Describe one medical/ethical issue that was raised in your lifetime involving politics. How was poli...

A: In light of the recent pandemic that has created shockwaves globally, disruptions pertaining to the ...

Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify t...

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each o...

Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...

A: The left and right hemispheres of the brain process different types of inputs. The left hemisphere p...

Q: The enzyme trypsin is sold as a dietary supplement.What happens to trypsin taken with food

A: Introduction Enzymes act as catalysts that helps in speeding up a chemical reaction. 

Q: Check All That Apply As exposure to X-rays increased, the ratio of type 1 to type 2 outcomes increas...

A: 1. What results did muller obtained? ANSWER: The explanation for the aforesaid experiment is given b...

Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...

A: Epistasis occurs when the expression of one gene is influenced by the activation of one or more gene...

Q: A molecule that donates electrons becomes____ , and the one that accepts the electrons becomes_____ ...

A: Redox reaction consist oxidation and reduction reaction. Photosynthesis is an excellent example of r...

Q: State the role of carbon fixation in photosynthesis

A: To define carbon fixation, we must first define fixation. Fixation, in general, refers to the proces...

Q: 1. In guinea pigs, black coat color (B) is dominant over white (b), and short hair length (H) is dom...

A: Allele - Alternate pair of a gene present on a specific locus/ site on homologous chromosomes. Domin...

Q: What is the  life cycle of sea lampreys, and the various control methods for lampreys intersect with...

A: Lamprey or Petromyzon which is commonly known as jawless fish . Lamprey is parasitic in nature use t...

Q: What are two important points that are required for both host and viral DNA replication?

A: Viruses lack cell machinery. Since viruses lack their cell machinery, they completely depend upon th...

Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...

A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...

Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...

A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...

Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.

A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...

Q: Fluid in the lymph system mostly comes from what leaks out of capillaries O True O False Animals wit...

A: The lymphatic system is another circulatory system present in the body. The composition of the lymph...

Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...

A: The study of what makes a certain action in a specific scenario the proper thing to do is known as e...

Q: Beginning physics students are often taught the basicconcepts of thermodynamics with two phrases: Fi...

A: Introduction A thermodynamic system is a body of matter and/or radiation that is separated from its ...

Q: The electrochemical gradient across the plasma membrane Group of answer choices is caused by more s...

A:     sodium concentration is more in outside the cell than the inside of the cell.  Sodium potassium ...

Q: On which sex is the frontonasal angle sharp and angular?

A: The answer to this question is B. i.e. females. They have the frontonasal angle sharp and angular. H...

Communities and Ecosystems

Ecology contains two words: Eikos means dwelling, and logy means to study, so the combined meaning is studying habitat or living.