The Calvin cycle in CAM photosynthesis occurs in O bundle sheath cells. O xylem cells. O mesophyll cells. O lower epidermis cells.

Q: Based on taxonomic judgment, a taxonomist decides to split the 60 species of the genus Conostylis in...

A: Introduction:- Genus is a taxonomic rank that is commonly employed in the scientific classification ...

Q: Microstimulation of area MT in humans would most likely influence visual processing of     a. color...

A: Microstimulation is a technique for researching the neurological underpinnings of perception. The pr...

Q: Why has the inventionof communication had the greatest influence on our lives

A: Communication holds a great role in exchanging knowledge, sharing thoughts, information and many mor...

Q: A person with muscle cramp in shallow water should try to relax muscle by stopping the activity and ...

A: Maintenance of physical fitness is one of the essential requirements in the present world. For the p...

Q: The enzyme trypsin is sold as a dietary supplement.What happens to trypsin taken with food

A: Introduction Enzymes act as catalysts that helps in speeding up a chemical reaction. 

Q: Hypothetical balanced food chain. Sun and Earth supply 6 units of energy to each plant. For higher t...

A: Introduction: Each step of a food chain is termed trophic level. Example, Grass → Insect → Frog → Sn...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: What provides the negative charge associated with DNA? The phosphate groups The nitrogenous bases Th...

A: DNA (Deoxyribonucleic acid) is a molecule that is made up of two polynucleotide chains that coil aro...

Q: Chimpanzees, gorillas, and orangutans all have 48 chromosomes, whereas humans have 46. Human chromos...

A: When a part of a chromosome breaks off and gets translocated to another chromosome, leading to genet...

Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?

A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...

Q: Using the images provided below, develop your own dichotomous key through the format given. An examp...

A: The system by which scientists classify living species is known as biological categorization. Simila...

Q: During which phase does cytokinesis begin? What cell parts migrate to the poles during prophase? Wha...

A:  Cell division in eukaryotes can be either mitosis or meiosis. Mitosis is an equational division in ...

Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...

A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...

Q: 1. Your roommate has noticed that you now spend most of your time studyingmicrobiology and has becom...

A:

Q: What are the three key features used to read chromosomes? Go to using karyptypes to predict genetic ...

A: Given: Chromosomes are long threadlike structure that is found inside the nucleus of cell. It is mad...

Q: For water to vaporize O energy must be supplied. both energy must be supplied and hydrogen bonds bro...

A: Introduction: The process through which a liquid state changes into a vapour state is known as vapor...

Q: TRUE OR FALSE

A: Puberty is the time when a boy or girl becomes sexually mature. It occurs between ages 10 and 14 for...

Q: PLEASE ANSWER

A: Introduction:- mussels reproduce in an unusual and complex way, which includes a brief, mandatory pe...

Q: Use the dichotomous key in Table 2 to identify a gram-negative rod that ferments lactose and uses ci...

A: Bacteria are ubiquitous, mainly free-living organisms with only one biological cell. They are indeed...

Q: А C

A: Morphology: The metacercariae, O. felineus has the similar morphology to those of the liver flukes. ...

Q: Sunhil suffers from a stroke and loses the ability to move his right arm and hand. However, after ph...

A: * stroke mainly affects the shoulder,elbow and upper limb and hand. *Stroke will usually affect the ...

Q: If a plant that is heterozygous for all theses characters is crossed with a plant homozygous dominan...

A: Mendel choses seven different traits " Pea shape round or wrinkled  Pea color green or yellow  Pod s...

Q: You are studying a transport protein. It appears to bind temporarily to the molecule to be transport...

A: 1. ANSWER;- This is an example of facilitated diffusion. The molecule is a competitive inhibitor. -I...

Q: what advantages do regulatory systems provide to the organisms?

A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...

Q: QUESTION 12 Ack! Your nematode cultures are infested with a pesky, but novel bacterium! You decide t...

A: Speciation is the process through which one genetically related population splits into two populatio...

Q: Which of the following effects is produced by the high surface tension of water?   Group of answer...

A: Due to the cohesive nature of the water molecules, surface tension can be defined as a feature of a ...

Q: explain this LAPTM5 restricts HIV-1 and Vpr counteracts the restriction

A:  Lysosomal Protein Transmembrane 5 ( LAPTM-5) help in transportation of of HIV-1 envelope into lysos...

Q: In what direction is there a net movement of particles along their concentration gradient? Would you...

A: Diffusion is the movement of substances in a passive way.  

Q: What do non-parasitic lampreys do?

A: Answer 

Q: All antioxidants_____ . a. prevent other molecules from being oxidized b. are coenzymes c. balance c...

A: Introduction: Human or natural antioxidants may be able to prevent or delay various types of cell da...

Q: most hydrophobic molecule listed below would be

A: Ans 1.  C2H6   Ans.2. Dehydration reactions assemble polymers, and hydrolysis reactions break down p...

Q: Why are hydrocarbons insoluble in water? O They are lighter than water. O They are hydrophilic. The ...

A: Hydrocarbons are organic molecules are made up of hydrogen and carbon. The long chains of carbon are...

Q: Which of the following exhibits Invoked Organization? i. Regal Angelfish ii. Orb web spiders iii. He...

A: Though every living and non-living thing in the world appears to follow its own pattern, a close exa...

Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no

A: Arteries are constantly under stress. The aorta and pulmonary arteries, which are closest to the hea...

Q: What are the various names of articulations based on movement?

A: Articulation is a joint between bones or cartilage in the skeleton of an animal.   Joints or articul...

Q: Pteridophyta(Fern) Alternation of Generation. What are the structures in the fern plant life cycle t...

A: The fern life cycle requires two generations of plants to complete itself. This is called Alteration...

Q: 1) Placing phospholipids in water will spontaneously form a spherical structure called a: Group of a...

A: 1)Placing phospholipids in water will spontaneously form a spherical structure called Ans)liposome E...

Q: What is genetic engineering? What organisms can it be performed on? Please give an example of at lea...

A: * Genetic engineering is also known as gene manipulation or modification. * It is a process to alter...

Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...

A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...

Q: Which type of bone has a net-like appearance? Group of answer choices Cortical/Compact Bone No answe...

A: Bones are the structure which help in the formation of the structural unit of the body .

Q: which objective lens is in place if the object you are viewing is magnified 1000x? (assume ocular le...

A: As if we known that microscope  amplifies the image of an object, a microscope is widely used to vie...

Q: Match the definition to its corresponding term. Formation of a pilus to allow genetic exchange betwe...

A: Answer 

Q: You are living through history due to the Covid-19 pandemic and now have real-world experience relat...

A: COVID-19 is the biggest global event and challenge of our lifetimes, Mostly this pandemic has left o...

Q: What can be done with the food dye to utilize it as an additive biocompatible material to improve th...

A: 3D bioprinting offers great potential to fabricate highly complex constructs with precise control of...

Q: Create your own flow diagram of the genetic engineering process using the 5 major steps.

A: Genetic engineering is the practice of altering an organism's genetic structure utilizing recombinan...

Q: Reproductive modes can be defined based on energetic provisioning (lechithotrophy vs. matritrophy) o...

A: Based on the mode of reproduction , animals can be classified. Based on the type of partition (parit...

Q: 1. Enumerate and discuss the illuminating parts of the microscope and give their respective function...

A: A microscope is an optical device that magnifies pictures that are too tiny to see with the naked ey...

Q: Given a sequence of amino acids explain the type of secondary structure you will expect the protein ...

A: Amino acids are classified as the biomolecules that comprise the amino group as well as a carboxylic...

Q: an insect population lives on trees. over time, more trees with light colored bark grown in their ha...

A: Introduction:- Camouflage (noun) is defined as the act of concealing one's physical appearance. Camo...

Q: 4. Comparative Morphology Data. Using your text and prior knowledge, determine the morphological cha...

A: Characteristics table attached below If character is present mark in "+", and if absent mark in '--'...

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.