The fox operon, which has sequences A, B, C, and D (which may represent either structural genes or regulatory sequences), encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects, where a plus sign (+) indicates that the enzyme is synthesized and a minus sign (-) indicates that the enzyme is not synthesized. Fox present Mutation in sequence Enzyme 1 Enzyme 2 Enzyme 1 Enzyme Fox absent No mutation A D + +| | +

The fox operon, which has sequences A, B, C, and D (which may represent either structural genes or regulatory sequences), encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects, where a plus sign (+) indicates that the enzyme is synthesized and a minus sign (-) indicates that the enzyme is not synthesized. Fox present Mutation in sequence Enzyme 1 Enzyme 2 Enzyme 1 Enzyme Fox absent No mutation A D + +| | +

Name: Is the fox operon inducible or repressible? The fox operon, which has
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Is the fox operon inducible or repressible? The fox operon, which has sequences A, B, C, and D (which may representeither structural genes or regulatory sequences), encodes enzymes 1 and 2.Mutations in sequences A, B, C, and D have the following effe

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

. In an effort to determine the location of an operator sitefor a negatively regulated gene, you have made a seriesof deletions within the regulatory region. The extent ofeach deletion is shown by the line underneath the sequence, and the resulting expression from the operon(i = inducible; c = constitutive; − = no expression) isalso indicated.... GGAT C T T AGCCGGCTAACATGATAAATATAA......C C T AGAATCGGCCGA TTGTA C T A TTT ATAT T ...1 i2 –3 c4 –5 ca. What can you conclude from these data about thelocation of the operator site?b. Why do you think deletions 2 and 4 show no expression of the gene?
You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH, andhupG. Diagram the mRNA for this operon, showingthe location of the 5′ and 3′ ends, all open readingframes, translational start sites, stop codons, transcription termination signals, and any regions thatmight be in the mRNA but do not serve any of thesefunctions.
A strain of E. coli has the genotypes shown below at the lac operon, where I = regulator gene, P = promoter, O = operator, Z = βgalactosidase gene, and Y = permease gene. The superscript+ indicates a wild-type allele,c indicates a constitutive mutation, and− indicates a defective mutation. For each genotype, indicate whether the enzyme will be synthesized or not synthesized when lactose is present or absent by placing a + for synthesis occurring and a − for synthesis not occurring in the appropriate blank. Explain your reasoning for each answer.
Suppose you have six strains of E. coli. One is wildtype, and each of the other five has a single one of thefollowing mutations: lacZ−, lacY−, lacI−, oc, andlacIS. For each of these six strains, describe thephenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expressionbut cannot serve as a carbon source for bacterialgrowth because it cannot be cleaved byβ-galactosidase; (2) X-gal cannot serve as a carbonsource for growth; (3) E. coli requires active lactosepermease (the product of lacY) to allow lactose,X-gal, or IPTG into the cells.] Colony color in medium containing glycerol as theonly carbon source and X-gal, but no IPTG.d. Colony color in medium containing high levels ofglucose as the only carbon source, X-gal, andIPTG.e. Colony color in medium containing high levels ofglucose as the only carbon source and X-gal, butno IPTG
. Suppose you have six strains of E. coli. One is wildtype, and each of the other five has a single one of thefollowing mutations: lacZ−, lacY−, lacI−, oc, andlacIS. For each of these six strains, describe thephenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expressionbut cannot serve as a carbon source for bacterialgrowth because it cannot be cleaved byβ-galactosidase; (2) X-gal cannot serve as a carbonsource for growth; (3) E. coli requires active lactosepermease (the product of lacY) to allow lactose,X-gal, or IPTG into the cells.]a. Growth on medium in which the only carbonsource was lactose.b. Colony color in medium containing glycerol as theonly carbon source, X-gal, and IPTG
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.
The lac operon of E. coli controls the expression of genes that code for enzymes involved in lactose metabolism. Mutations to various regions of the lac operon have been discovered which affect both the control of gene expression and the function of the gene products. These mutations include: I - = produces a repressor protein that cannot bind to the operator region IS = produces a repressor protein that cannot be removed from the operator region OC = cannot bind a repressor protein Z - = produces a defective (non-functioning) β-galactosidase enzyme + = wild type Detail the functionality of the lac operon under the following genetic and cellular conditions. You do not need to consider the role of CAP in your analysis. Genes Repressed (yes/no) Constitutive (yes/no) IS O+ Z+ IS OC Z+
The lac operon of E. coli controls the expression of genes that code for enzymes involved in lactose metabolism. Mutations to various regions of the lac operon have been discovered which affect both the control of gene expression and the function of the gene products. These mutations include: I - = produces a repressor protein that cannot bind to the operator region IS = produces a repressor protein that cannot be removed from the operator region OC = cannot bind a repressor protein Z - = produces a defective (non-functioning) β-galactosidase enzyme + = wild type Detail the functionality of the lac operon under the following genetic and cellular conditions. You do not need to consider the role of CAP in your analysis. Genes Repressed (yes/no) Constitutive (yes/no) I+ OC Z+ I+ O+ Z+ (Lactose present) I- O+ Z+
Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
Given the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +
A constitutive mutation in the lac operon may be of several types. [Note that constitutive means that the structural genes are always expressed, even if lactose is absent.] Name two types of constitutive mutations. Group of answer choices LacY- and LacI- LacOc and LacZ- LacZ- and LacI- LacY- and LacA- LacI- and LacOc