The Hardy–Weinberg principle may be applicable if (a) the population size is small (b) migration occurs only at the beginning of the breeding season (c) mutations occur at a constant rate (d) matings occur exclusively between individuals of the same genotype (e) natural selection does not occur

The Hardy–Weinberg principle may be applicable if (a) the population size is small (b) migration occurs only at the beginning of the breeding season (c) mutations occur at a constant rate (d) matings occur exclusively between individuals of the same genotype (e) natural selection does not occur

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter53: Introduction To Ecology: Population Ecology

Section: Chapter Questions

Problem 15TYU

See similar textbooks

Related questions

Q: 6. Consider the following biochemical pathway: precursor compound I enzyme enzyme A В compound II…

A: The fungus Neurospora was used by Beadle and Tatum to manipulate the biochemical outcomes of…

Q: Orientation to Intection Prevention Ex Which of the following measures should be taken to avoid…

A: The true answer is.. Listen to warnings from the owner or others who have worked with the animal

Q: How is RNAPol recruited to the correct place along the DNA to begin transcription at the +1 site?

A: Site of DNA where first nucleotide is transcribed is termed as +1 or initiation site.

Q: 9. For stabilization of disturbed brain functions in mental disease nootropic agents are widely used…

Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…

Q: Explain how epigenetic changes can contribute to tumorigenesis.

A: Tumors are clumps of cells formed by uncontrollable cell division. Tumorigenesis is the uncontrolled…

Q: The hypothalamus releases antidiuretic hormone that reduces urine formation in the kidney. Under…

A: Antidiuretic hormone (ADH) is a hormone that helps your body regulate the amount of water that…

Q: Define 'oestrus’ and ʻmenstrual cycles.

A: These are the characteristics of the oestrus cycle and the menstrual cycle: When the female is in…

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

Q: In an investigation of fruit fly behavior, an enclosed choice chamber was used to test whether the…

A: A spatial distribution is a graphical representation of a phenomenon's distribution throughout the…

Q: In sexual differentiation, parts of the male reproductive system develop from the:

A: The formation of different proteins that lead to formation of different cells and thereby tissues…

Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…

A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…

Q: Name 2 sources of variation produced during meiosis.

A: Meiosis is a form of cell division in which the reduction of the number of chromosomes to half…

Q: a. What role do miscellaneous structures (where applicable) play in the organism's role for…

A: INTRODUCTION External structures are the outer covering all all the livings organisms which provides…

Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…

A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…

Q: The major difference between retrotransposons and retroviruses isa. retrotransposons encode reverse…

A: Introduction:- The most well-known retrovirus is HIV, although there are many others in the tiny…

Q: sequences of peptides tha" of trypsin? eptadecapeptide Cortistau

Q: What exactly does the phrase "FMS option" imply and what is its significance?

A: Exercise also aids in the reduction and alleviation of pre-existing health problems. Exercising…

Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates are…

A: * Enzymes are proteins speed up chemical reactions by binding to substrate. *Enzymes are also…

Q: -In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant for…

A: 1. In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant…

Q: Arthropod muscle fibers typically do not generate actionpotentials. Using your knowledge of their…

A: Introduction :- Most arthropods move by using their segmental appendages, and the exoskeleton and…

Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…

A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…

Q: Axons in the nerves. a. increase the surface area of the cell b. receive signals from neighboring…

A: Axons are the part of nerve cell or neuron.

Q: Which of the following statements is true about cladograms? Cladograms are used to show the O…

A: A cladogram is a diagram that shows the relationships between different groups of organisms. It is…

Q: Mention and describe the two types of bacterial resistance to antibiotics.

A: The emergence of resistance among the most essential bacterial pathogens is recognised as a main…

Q: The hemoglobin in mammalian blood is usually thought ofsimply as increasing the amount of O2 that…

A: Introduction :- Hemoglobin is a protein found in red blood cells that allows blood to transport…

Q: Insects are ectothermic and the respiratory rate is usually proportional to the temperature of the…

A: TROPICS:- Insects adapt in the tropics by undergoing anatomical modifications. Example can be the…

Q: mechanisms of locomotion that this organism can have?

A: 1.They move by using their muscles to push their scales against the ground

Q: what is the purpose of calcium ion in fertilization?

A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…

Q: What bacteria grow on both a MacConkey agar plate and Mannitol Salt agar?

A: Selective media The media is a kind of growth media which only allow the growth of a perticular…

Q: describe the events that occur over the 6 day period following fertilization of an ovum

A: An ovum or egg is the female gamete of an individual. It can fertilize with the male gamete to form…

Q: What are ferns? Describe its salient features.

A: Ferns can be found in a variety of habitats, including warm, moist tropical regions and dry, rocky…

Q: Explain "Numerical taxonomy" briefly.

A: Introduction In this question we will explain the Numerical taxonomy.

Q: methods with their use, mode of action, etc. disinfectant standard Standard of disinfectants v…

A: Chemical control means the utilization of sanitizers, sterilizers, anti-toxins, and chemotherapeutic…

Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…

A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.

Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: What do you think accounts forthe variation in per capita ecological footprints among societies?Do…

A: The Ecological Footprint quantifies the amount of biologically productive land and sea area occupied…

Q: Deﬁne pulse.

A: Pulse is a medical terminology used to address the process of regular expansion of an artery.

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: The term "phenotype" refers to the observable physical properties of an organism; those consist of…

Q: Give two vegetative and two floral differences between grasses and sedges

A: Grasses are the member of family Poaceae and sedges are the member of family Cyperaceae. Both shows…

Q: The phenotype of many human behavioral/mental traits is best described as

A: Here I described the phenotype of behavior/mental traits in human.

Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…

A: Answer

Q: What is the purpose of the central canal? O houses blood vessels and nerves O houses adipose tissue…

A: The central canal of the spinal cord houses cerebrospinal fluid that nourishes the spinal cord. Here…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Hereditary retinoblastoma generally affects children in both eyes, while spontaneous retinoblastoma…

A: Retinoblastoma is defined as a type of cancer that starts in the retina and is located in the back…

Q: What characteristic is the most recent derived characteristic? Explain your answer

A: Derived traits are those that just appeared (by mutation) in the most recent ancestor. Organisms…

Q: In a genomic analysis looking for a specific disease gene,one candidate gene was found to have a…

A: The discovery, measurement, or comparison of genomic properties such as DNA sequence, structural…

Q: biologists were able to estimate that, on average, only 5 fisher kits (young animals) survived to…

A: Introduction Aquaculture is also known as aquafarming, is the controlled process of cultivating…

Q: Compare and contrast anthropocentrism, biocentrism, and ecocentrism. Explain how individuals with…

A: Anthropocentrism is defined as the people who have a human-centered view of a relationship with the…

Q: B5. When a tapeworm obtains nutrition from the human intestine, but causes harm to the human host in…

A: Different types of species interactions are found that are classified according to their nature. In…

Concept explainers

Ecological Interactions

The study of the ecological interactions between living beings and their physical environment, including humans, is ecology. It aims to understand the crucial links between plants and animals and the world around them. Ecology also gives knowledge on the advantages of ecosystems and how we may use Earth resources to ensure that future generations have a healthy environment.

Question

Video Video

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If natural selection has no foresight,how can it explain features that seem to prepare organisms for future events? For example, deciduous trees at high latitudes drop their leaves before winter arrives, male birds establish territories before females arrive in the spring, and animals such as squirrels and jays store food as winter approaches.
Which of the following statements is not true about the concept of natural selection? Group of answer choices A-Geographical isolation contributes to the formation of new species as individuals begin to adapt to different environments B-Natural selection explains the increase in the yield of kernels per corn plant over the last several thousand years C-Infers that later generations may be distinct from ancestral ones, or a new species can appear D-Selective pressures cause distinct species to develop E-Suggests that over long periods of geological time, successful variations accumulate in a population
Applying your knowledge of genetics, natural selection and evolution, how is the positive response to global climate change possible? Please explain using the terms “population” and “gene pool” and the types of natural selection we discussed. Is it possible that these situations can increase the number of species? How?
In the Grants’ study of the medium ground finch, do you think the pattern of natural selection was directional, stabilizing, disruptive, or balancing? Explain your answer. If the environment remained dry indefinitely (for many years), what do you think would be the long-term outcome?
Which of the following best explains the connection between increased competition and the evolution of a species by natural selection? Individuals migrate to another area in order to avoid competition for limited resources in the current ecosystem. Individuals that have traits that allow them to outcompete others survive better and produce more offspring. Individuals must become stronger to compete for resources, and this increased strength is passed on to the next generation. Individuals that must compete for limited resources are more likely to have diseases that cause mutations.
The graph shown here is from a natural selection lab in which students "hunt" for candy in different simulated environments. Examine the graph and answer the questions below it. Approximately how many of each candy species were present in generation 1 (round to the nearest 10)? Which candy species was the least able to hide from the predators in Generation 3? Which candy species had the best survival rate throughout the first four generations of the simulation? Does this data support the hypothesis that Snikers were the most fit for the simulated environment? Please answer yes or no
One way to prevent a small population of a plant or animal species from going extinct is to deliberately introduce some individuals from a large population of the same species into the smaller population. In terms of the evolutionary mechanisms discussed in this chapter, what are the potential beneﬁts and drawbacks of transferring individuals from one population to another? Do you think biologists and concerned citizens should take such actions?
If you had measured a set of morphological traits (beak depth, wing length, leg length, tail length, body size) in both the parent and offspring generations, would it be useful to measure any changes in these traits in the parent generation after the drought killed the birds with shallower beaks? Could any such changes measure a correlated response to natural selection on beak depth? Why or why not?
How could you add the five steps of natural selection for a Bengal tiger? please relate this to adaptations and natural selection
Adaptive radiation a. is the result of enriched uranium used in power plants. b. is the evolution of closely related species adapted to use different parts of the environment. c. results from genetic drift. d. is the outcome of stabilizing selection favoring the maintenance of adaptive traits.
Do you believe that because insect beak length has changed in opposite directions in the Florida and the Texas populations that we have stronger evidence that natural selection was acting directly on beak length in these populations? Or is it equally likely that natural selection is only acting on a trait correlated with beak length in the Florida and Texas populations?
Is the rate of evolution, based on the supply of genetic variation and the strength of natural selection, fast enough to account for the emergence of major new kinds of organisms, such as birds and whales?