The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare the ability of telomerase with respect to DNA polymerase to synthesize DNA strand. The template used by the telomerase and the resulting sequence having tandem repeats.

The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare the ability of telomerase with respect to DNA polymerase to synthesize DNA strand. The template used by the telomerase and the resulting sequence having tandem repeats.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 15QP

See similar textbooks

Related questions

Q: Explain and distinguish between characters, traits, genes, and alleles

A: Genetics is a branch of biology that studies genes, genetic variation, and heredity in living…

Q: With arrows, sketch the transfer of energy that occurs during the electron transport phase of…

A: Carbon dioxide and water is being formed by gradually breaking the glucose in the process of…

Q: What statement about lipid-soluble signaling is FALSE. O These signals often alter gene expression…

A: The cell membrane of cells is composed of amphipathic phospholipids.

Q: ess dense. Why is this change in the water beneficial to the organisms living in the lake? As the…

A: Water molecules can make intermolecular and intramolecular hydrogen bonds.

Q: Explain the ABO blood system as an example of multiple alleles and codominance; be sure to discuss…

A: ABO blood group system, the classification of human blood based on the inherited properties of red…

Q: You decide to examine call duration in Canadian toads at Big Lake near Edmonton. Call duration in…

A: Hardy Weinberg equilibrium is found in a population with large population size, no migration, no…

Q: Do these two trees (a and b) depict equivalent relationship? Explain the reasoning of your answer in…

A: Phylogenetic tree:- These type diagram only use for representing the evolutionary relationship…

Q: Which of the following statements is true of a species that has a chromosome number of 2n = 36? a) A…

A: Introduction The DNA molecule is coiled into thread-like structures called chromosomes in the…

Q: List the three main ways that aerosol deposition occurs within the airways

A: Introduction The process through which aerosol particles accumulate or deposit on solid surfaces,…

Q: Which of the following terms would blue eyes represent in an organism? A. genotype B. phenotype C.…

A: The characteristics of an organism is determined by the expression specific genes which controls the…

Q: In dogs, albino white coat color is an autosomal recessive trait, while black coat is a dominant…

A: Autosomal recessive trait Autosomal traits are those that are controlled by somatic cells (not the…

Q: Which of the following increase plasma glucose levels during fasting or exercise? Group of…

A: In this question we have to describe about effect of cellular response during exercise and fasting.…

Q: Do you think, autapomorphy conveys a lot of information about phylogenetic relations hip? Please…

A: Phylogenetics is the branch of biological science that deals with the inter-relationships among…

Q: Explain how we know that there are NO races, or biological subspecies, in modern humans. In your…

A: *While races may exist in a cultural sense in humans, biological conceptions of race are required to…

Q: Inheritance of multiple genes: 8. A pure-bred grey cat mates with a pure-bred chocolate cat: a. What…

A: The entire process of heredity is based on inheritance, which is why the offspring are identical to…

Q: The comparison between chromosomal localization and structure in interphase and M (mitotic) phase.

A: The cell cycle is a crucial process that results in the creation of two offspring cells from a…

Q: A patient, 40 years old, complains of weakness, fatigue, abundant menstruation. Upon examination,…

A: Uterus:- It is a pyriform-shaped female reproductive organ that lies in the pelvic cavity. It is the…

Q: Biology Resource partitioning due to disruptive selection is more likely to cause speciation in:…

A: Biological resource partitioning and speciation due to disruptive selection.

Q: // Which of the following proteins or drugs (that we learned in class) are anti-angiogenesis agents?…

A: Introduction :- Angiogenesis is the physiological process by which new blood vessels develop from…

Q: Do explain shortly. Question:- In new drug discovery in the US in the past 35 years, which has…

A: Introduction Pharmacology is basically when we talk about certain chemicals or chemically active…

Q: 1. 1 || ||| = IV 845 10 3 1 2 3 a. Determine the mode of inheritance. Be very specific: b. If couple…

A: Inheritance pattern is a type of pattern which evaluates how traits are transmitted from parental…

Q: new virus has recently been discovered that infects human lymphocytes. The virus can be grown in the…

A: There are few important points about viruses : Viruses are intracellular parasite and are simplest…

Q: 3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human…

A: RT - qPCR - Quantitative reverse transcription PCR (RT-qPCR) is used when the starting material is…

Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…

A: Answer :- Telomerase :-Some cells have the ability to reverse telomere shortening by expressing…

Q: III. OSMOREGULATION DIRECTIONS: Read and analyze the phrases provided below. Using the phrases on…

A: The activity of regulating salt and water balance (osmotic equilibrium) across membrane in the body…

Q: The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference…

A: Cells They are the basic, fundamental entity of life.

Q: Question:- Based on your selected mode of inheritance, show the genotypes for the following…

A: Pedigree analysis and genotype of the offsprings.

Q: 1- A. How is the blood in the pulmonary artery and pulmonary veins different from the blood in the…

A: The heart, capillaries, and blood are all part of the blood circulatory system, that ensures that…

Q: Based on your understanding, list down FIVE (5) important points regarding DNA methylation process…

A: Introduction DNA methylation is defined as a biological process in which methyl groups will be added…

Q: Explain how an individual with emphysema will have a difficult time carrying out respiration.

A: Emphysema is a medical condition that majorly affects the lungs of an individual. The lungs are…

Q: In some instances, crops are infected by a less virulent strain of the plant pathogen to induce the…

A: Vural resistance Viruses are microorganisms that are non-living unless they find a specific host,…

Q: 8. The percentage of Calories from fat for the yogurt is: A. 21%. B. 13%. C. 10%. D. 5%.

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Our new mode of teaching and learning which is full online requires us to be using our computers,…

A: Introduction The term "online learning" refers to education that occurs over the internet. It's…

Q: Identify the single most correct choice: a) DNA replication is a non-conservative process. b)…

A: DNA or Deoxyribonucleic acid is the genetic material in most higher organisms. RNA is Ribonucleic…

Q: 1. Select any part of the articular cartilage. Submit Refresh View

A: Introduction Cartilage is the most common type of connective tissue found in the human body. It is…

Q: How does the yolk help in forming a permanent solution?

A: How does the yolk help in forming a permanent solution?

Q: You are studying bacterial cells and you find bacteria with a mutation that causes it to produce…

A: The DNA is double stranded in the bacteria . During the replication these two strands of the DNA…

Q: Explain the terms homozygous and heterozygous in relation to genotypes, and state/identify the…

A: By homozygous, it refers to the genetic constitution of an individual having two identical copies…

Q: Skeletal remains are discovered at an archeological site. X-rays of the femur show evidence of a…

A: Epiphyseal plate is a part of long bone where new bone growth takes place. Growth plates only…

Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…

A: Only when both strands of DNA are been allows to separated from one other can state the DNA in the…

Q: 1. 1 || ||| IV 100 2 a. Determine the mode of inheritance. Be very specific: b. If couple II-8 and…

A: Introduction A pedigree is a chart that shows a family's genetic history over several generations.…

Q: You discover an E. coli mutant that has a non-functional DNA polymerase III. Such a bactèria; a)…

A: The DNA replicates itself several times during the replication process. It is a biological…

Q: 4. Given a cross between: AaBbCCDDEeFfGghh x Aa BbccDdEeFfGGhh Where traits A, D, G, H exhibit…

A: Number of possible gametes = 2n n = number of heterozygous gene pairs The first individual is…

Q: b) Organic matters may interfere with heat treatment of bacterial growth control. ( c)…

A: Please follow step 2 for detailed explanation.

Q: Neural prostheses are a series of devices that can substitute a motor, sensory or cognitive modality…

A: The study of the neurological bases of behavior and mental processes is known as behavioral…

Q: Can the side-chain of glutamine make a bidentate interaction in the major groove at a G-U wobble…

A: Introduction The RNA world is a proposed period in the evolution of life on Earth in which…

Q: True or false. Microtubules and kinesin are responsible for ensuring that the Golgi Apparatus…

A: Introduction Golgi apparatus or golgi apparatus or golgi complex is an membrane bound cell organalle…

Q: What happens if ATP is not available in the sliding filament theory? When is the maximum force…

Q: You genetically modified a bacterium so it can only produce ribosomes from a plant. The most…

A: As soon as mRNA is transcribed in bacteria, it is translated into protein. Bacteria, unlike…

Q: Compared to DNA, RNA; a) Uses thiamine b) Has an OH group on the 3' carbon and DNA does not Oc) Is…

A: DNA or Deoxyribonucleic acid is the genetic material in humans. RNA or ribonucleic acid in some…

Question

Describe.

The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare the
ability of telomerase with respect to DNA polymerase to synthesize DNA strand. The template used by the
telomerase and the resulting sequence having tandem repeats.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The function of enzyme involved in base excision repair isa) Addition of correct baseb) Addition of correct nucleotidec) Removal of incorrect based) Removal of phosphodiester bond
Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Explanation of similarity of RT- PCR components to the components or pupose of DNA replication
Polymerase chain reaction is—   a reaction involving a chain of different types of polymerases acting successively on a DNA. a way DNA replicates in the living cell. governed by the Henderson-Hasselbalch equation. a chain reaction mediated by polymerase to amplify DNA fragments of defined sequence. DNA polymerization without a template.
The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3
Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding proteins keep the strands separated and yet do not impede the ability of DNA polymerase to replicate the strands.
The semi discontinuity in DNA replication. Is it biologically possible for DNA to undergo replication in vivo, without the lagging and the leading strands? In PCR, we also start with an antiparallel strand of DNA. Does this also mean that replication is semidiscontinuous in in vitro replication?
Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differencesbetween the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
DNA polymerases add a deoxyribonucleotide triphosphate to the 5' hydroxyl group of a growing DNA chain (the primer strand). True or false
Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the hyperchromic effect).
Multiple origins of replication on the DNA molecule of eukaryotic cells serve to Question 41 options: remove any errors in replication that may have occurred create multiple copies of the DNA molecule at the same time shorten the duration of time necessary for DNA replication reduce the number of "replication bubbles" that occur in the DNA double helix during replication assure the correct orientation of the two strands in the newly growing double helix