The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.

The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

What effect would inhibitors of histone deacetylases have upon transcription? Group of answer choices They would increase transcription by making the chromatin more compact They would increase transcription by making the chromatin less compact They would decrease transcription by making the chromatin more compact They would decrease transcription by making the chromatin less compact For this question, we will consider a eukaryotic mRNA that has four exons (E1, E2, E3, E4) and three introns (I1, I2, I3). What could occur if a protein were to bind over the 3' splice site of intron 2 (I2)? Group of answer choices The processed mRNA would consist of: E1+E2+E3+E4 The processed mRNA would consist only of: E1+E3 The processed mRNA would consist only of: E3+E4 The processed mRNA would consist of: E1+E2+E4
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
Name four major classes of DNA-binding proteins that are responsible for controlling transcription, and describe their structural features.
Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows (;) indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Give all the possible fully processed mRNAs that could be produced from transcripts of this gene (you don't need to draw anything, just list the regions that would be included in each mRNA by number).
What is the production of RNA called and what is the enzyme that catalyzes the process?What are the similarities and differences between the transcription process and the repli-cation processes?Concerning their biological function what is the difference between DNA and RNA? Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?What is the difference between plasma membrane and cell wall?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing. A. TFIIB C. TFIIH B. TFIID
Refer to figure, which shows the distribution of histone H2A.Z on nucleosomes near a transcription start site. What experimental technique would have been used to generate the data for this figure? Briefly describe the operation of this technique.
What is meant by the term chromatin remodeling? Describe the importance of this process to transcription.
In 3-4 sentences eachExplain the difference between prokaryotic and eukaryotic transcription. Explain the difference between an activator and a repressor? Explain the difference between a promoter and an enhancer? Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?
Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?