The most significant cause of the loss of biodiversity isa. habitat loss.b. pollution.c. exotic species.d. disease.e. overexploitation.

Q: A fatigued muscle lacks sufficient oxygen for the aerobic respiration to supply needed ATP. The…

A: During aerobic metabolism of glucose in a cell, the glucose gets metabolized to pyruvate or pyruvic…

Q: Structure and functions of root hair cells?

A: The root hair cell is an epidermal offshoot that forms hairs of the root of the plant.  Essentially,…

Q: Describe the evidence that Neanderthals buried their dead. Do you think this type of behavior is…

A: Recent research states that Neanderthals might have also deliberately buried their dead like modern…

Q: 2. How does the pulmonary circuit and systemic circuit work?

A: To maintain life, our body uses both the pulmonary circulation and the systemic circulation. We'll…

Q: What is the difference between a follicular cyst and a corpus luteum cyst?

A: Asymptomatic women frequently have ovarian cysts, also known as ovarian masses or adnexal masses,…

Q: Identify the missing components and write their names against the numbers 1-7 given below:

A: Introduction The Wnt pathway is a signal transduction pathway that is known for the regulation of…

Q: n pea plants, tall (T) is dominant to dwarf (t) and yellow (Y) is dominant to green (y).  In a cross…

A: Note: We’ll answer the first question since the exact one wasn’t specified. Please submit a new…

Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU

A: Introduction The molecule that carries the genetic information necessary for an organism's growth…

Q: list and describe the ways meiosis increases variability; be able to discuss importance of genetic…

A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…

Q: Define biology

A: Science is the study of nature, the way natural things behave, and how they actually work in the…

Q: 1. Seeking shelter from the cold is an example of a(n). O O O 01:Pretest NPS Credit Recovery HS:…

A: Here i discuss about the seeking shelter from cold. Body temperature can be maintained by behavioral…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: . Critically evaluate the role and reliability of different diagnostic methods in use for difficult…

A: I will be answering the above question by taking Infective endocarditis(IE) as an example:- IE is a…

Q: How can the cell in our body organize into functional structure?

A: Human body can be compared to a complex machine. In all these aspects, the human body is much like a…

Q: 7. How does gas exchange occur between the alveoli and capillaries?

A: Gas exchange occurs in millions of Alveoli in the lungs and surrounding capillaries which envelopes…

Q: 1. What are the ingredients the device? 2. Working principle 3. What are the common malfunctions…

A: Introduction Kidney stones are tiny solid masses made up of salts in urine formed inside the kidney.…

Q: Lymphatic System Histology, Structures, & Functions

A: Like circulatory system, the lymphatic system, or lymphoid system, is an organ system in vertebrates…

Q: Jaden grows geraniums in his greenhouse. He has noticed that his flowers are not growing very well.…

A: Geranium: It is a bushy and aromatic plant. Its stem is cylindrical and woody at the base. It is…

Q: 1 Given the events of the cell cycle shown above, where would you predict there might be checkpoints…

A: Cell division is the process through which two daughter/new cells are produced from a parent cell.…

Q: An organism in a Domain also belongs to the same class. Select one: True False

A: Introduction: A single live entity is referred to as an organism. A living item is easy to observe,…

Q: Write:           A – if the item is associated with Transcription           B – if the item is…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: how bacteria can be used as biosensor to detect cancer causing chemical (carcinogenes) environmental…

A: Biosensor are biochemical devices which meansure bioloical and chemical reactions by generating…

Q: What is an organism that spreads disease germs to humans after biting and infected organism causes…

A: The diseases is a condition where the body reacts abnormally. Several ticks, flies, mosquitoes,…

Q: What is the equation that represents the mass balance of the exponential phase of bacterial growth?…

A: In exponential growth, a population's per capita (per individual) growth rate stays the same…

Q: List and describe the processes that make up the central dogma of biology which provides the path…

A: Central dogma is the process in which the genetic information flows from DNA to RNA, to make a…

Q: 2. Carbohydrates are needed for different cellular processes/components. Which statement is NOT an…

A:

Q: Under the guidance of y Vermi compost for your

A: Vermicompost is a product made by the decomposition process. Various worms are used for…

Q: Why is prompt treatment of pelvic inflammatory disease (PID) critical to reproductive health?

A: Introduction Pelvic inflammatory diseases are the diseases caused in the upper reproductive organs.…

Q: Ways in which fats are useful?

A: Introduction: Most dietary fats and oils are mostly composed of triglycerides. Mono- and…

Q: 4. What is the role of the diaphragm in the respiratory system? How does it work during inhalation…

A: The movement of oxygen from the outside environment to the cells within tissues, as well as the…

Q: 6. Originally, two species of finches lived in the Maldives. One species had long, narrow beaks…

A: Introduction : The steady transition of an organism from a simple to a more sophisticated form is…

Q: Explain the way to elucidate differences in tRNA needed in the human and mitochondrial genome.

A: The transfer ribonucleic acid is another name for the RNA. The molecules known as tRNA are in charge…

Q: Asexual plant probation cutting steps

A: Introduction Plants can reproduce naturally and artificially by various methods. Some lower plants…

Q: 1. There are four groups of plants. Each plant can be EITHER vascular or non-vascular and EITHER…

A: There are four groups of plants.  This includes- Moss (Bryophytes) - They are non-vascular and…

Q: Nitrogen fixation is the reaction of: conversion of gaseous N2 into a biologically useful form of…

A: Q. Nitrogen fixation is the reaction of: a)conversion of gaseous N2 into a biologically useful form…

Q: What is a model organism? A. used by science to be an example for how other organisms would respond…

A: Organism is a living being who is made up of cell or more than one cell. For example: Bacterial…

Q: Please help

A: All these terms are different scientific terms which are hidden in this puzzle. The arrangement of…

Q: What is the role of hormones and growth factors in the pathophysiology of breast cancer?

A: Breast cancer is common in females. It is also influenced by hormones and other growth factors. The…

Q: Cell Transport Method Passive or Active Process? Is process used to molecules move DOWN their…

A: The movement of a substance across the cell membrane is known as cell transports Cell transport is…

Q: Mortality, natality, immigration, emigration. Per capita growth rate Growth rate Population density…

A: Introduction :  A population is any group or species of organisms that may interbreed, exist in a…

Q: You then conduct a second experiment.  Wild-type and C3 deficient mice are each inoculated with a…

A: Introduction  A virus is an infectious microorganism made up of a protein-coated segment of nucleic…

Q: In 2017, 16 bison were released into Elk Island National Park. Within the next five years, 42 more…

A: Introduction :  The speed at which new members are added to the population per capita is referred to…

Q: Is a nucleus cell or virus

A: Nucleus:  The nucleus is a membrane-bound organelle in cell biology that is present in eukaryotic…

Q: Explain how knowledge of geography and economic help the biologist in understanding the life

A: The study of biology helps us to understand the living world around us and the interactions between…

Q: When do you think medical care becomes a public health responsibility, and what problems are…

A: The science of safeguarding and enhancing the health of individuals and their communities is known…

Q: Why is cystitis more common in women?

A: Introduction Cystitis is the condition which is referred to the inflammation in the urinary bladder.…

Q: Procedure A. Applying the terms of science The following fictional experiment demonstrates the use…

A: Science is a means of knowing that is always evolving and altering. Scientists are constantly…

Q: What is scientific consensus

A: Basically, a consensus defines a general agreement on a particular subject or matter. A example of…

Q: What kingdom monera

A: Introduction: Animal, plant, fungus, protist, and monera are the five kingdoms that make up the…

Q: Describe an easier method to detect the gene encoding for a specific toxin.

A: Gene:-  it consists of the sequences of nucleotide in DNA. And encodes a specific products including…

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.