The nucleotides from a bacterial cell were found to have the following abundances: 39% uracil; 41% adenine, 9% cytosine; 8% guanine. What type of molecule is the genome of the bacteria likely made of? a. Double stranded DNA b. Single stranded DNA c. Messenger RNA d. Double stranded RNA

The nucleotides from a bacterial cell were found to have the following abundances: 39% uracil; 41% adenine, 9% cytosine; 8% guanine. What type of molecule is the genome of the bacteria likely made of? a. Double stranded DNA b. Single stranded DNA c. Messenger RNA d. Double stranded RNA

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 6RQ: A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA...

See similar textbooks

Related questions

Q: 60. The action potential of a normal axon is shown on the graph. K* conductance is maximal at which…

A: Introduction :- An action potential (AP) is defined as a rapid rise and fall in the membrane…

Q: Cucumis sativus (cucumber) is a diploid plant with 7 chromosome pairs. Determine the following as…

Q: What stimulates Golgi tendon organs? A muscle is contracting with minimal tension. A muscle is…

A: Answer: A muscle is stretched nearly to its limit.

Q: Use the figure to answer the question. enzyme A enzyme B B A Refer to the metabolic pathway…

Q: Explain the value of working with a fungus that has linear asci. What can we map in these organisms…

A: Mapping the location of genes on a chromosome can be accomplished with a diploid organism by…

Q: Lab was on the translation process from mRNA to amino acid, post-translational modification of…

A: Introduction Protein biosynthesis is an important biological process that takes place inside cells…

Q: If twin brothers fathered 2 boys, (one each) by different women, would the 2 boys have any simular…

A: The human genome is a full set of nucleic acid sequences for humans, encoded as DNA in cell nuclei's…

Q: Who originally deserved Kudos for genetic engineering

A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…

Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…

A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction :- A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: More recent additions to the hominan phylogeny such as Ardipithecus pushed hominan origins back ~4.4…

A: The correct answer choice is - suggest that bipedalism may not be strictly related to savannah…

Q: One difference between the 'fishapod', Tikaalik, and the early tetrapod, Acanthostega, is... Group…

A: Tetrapod development began approximately 400 million years ago in the Devonian Period, with the…

Q: In reference to the following table: F1 ebony flies - 0 F1 non-ebony flies - 560 F1 stubbly…

A: Inheritance is the foundation upon which heredity is built. It is described as the process through…

Q: A charged tRNA is approaching the ribosome during the translation of an mRNA. The anti-codon…

A: Translation, as related to genomics, is the process through which information encoded in messenger…

Q: In our body, an enzyme called ______________ help break the bond between two monosaccharides when…

A: Digestive enzymes are proteins which aid in the digestion of food. The saliva glands and cellular…

Q: 49. Replication process: Transferring the genetic information from one cell to its daughters and…

A: Replication is the process by which dsDNA is copied to produce two identical DNA molecules. Genetic…

Q: absence of a telomere?

A: Telomere is a specialized structure of eukaryotic chromosome that is present in a terminal region of…

Q: Which of the following is the best example of a tumor promoter? A chemical that allows cells to…

A: Answer : Option B- a chemical that activates mTOR. Tumour promotors are agents or chemicals that…

Q: 6. Which are responsible for the template in the synthesis of proteins which in turn control the…

A: The protein synthesis takes place in the cytoplasm of the cell. The protein synthesis activity and…

Q: State the expected ratio of ebony to non-ebony flies in the F2 generation. State the expected…

A: The Ebony, non-Ebony, Stubble and non-Stubble are the phenotypic characteristics of a fly. According…

Q: Please answer asap 15) Which molecular tag selects cargo proteins for lysosome. What molecular tag…

A: In many animal cells, a lysosome is a membrane-bound organelle. They're spherical vesicles with…

Q: 12. A 26-year-old woman comes to the clinic for a routine health maintenance examination. She has a…

A: Introduction: Sexual assault occurs when perpetrators use force, threaten victims, or take advantage…

Q: Define each in two short sentences Allopatric speciation Sympatric speciation Adaptive radiation…

A: Evolutionary biology is a branch of biology which explores the mechanisms that led to the variety of…

Q: Neoplastic cells typically evade immunosurveillance. Explain how this occurs and describe how…

A: Neoplastic tells are the cancer cells which are created by the uncontrol division of a specific…

Q: 51. A 50-year-old man has diminished vibratory sensation on his right leg. Which of the following…

A: Spinal cord It is defined as a long, tube-like tissue band that connects the lower back to the…

Q: Which of the following receptor types will trigger the release of cytokines in macrophages? O A.…

A: INTRODUCTION Cytokines They are chemokines, interferons, interleukins, lymphokines and tumor…

Q: In the Primula plant, the blue flower color is due to malvidin, a pigment encoded by the completely…

A: The interaction shown in the Primula plant between its genes is definitely not the Mendelian one.…

Q: 1. What is the structural component of a DNA and how does each component function? 2. What is the…

A: 1. What is the structural component of a DNA and how does each component function? 2. What is the…

Q: Who discovered Salmonella Typhi, when it was discovered and

A: Salmonella enterica serotype typhi is a gram-negative bacterium that is responsible for typhoid…

Q: Compare and contrast monogamy, polygyny, polyandry, and promiscuity? Provide examples. Monogamy is…

A: Mating system classification provides qualitative insight into the overall mating dynamics that…

Q: please DEFINE your genotypic symbols, then list the most probable genotype of each of the…

A: 1)Black shaded square shows :- male with trait (affected males). Black shaded circle shows :- Female…

Q: Match the appropriate terms to their definitions TCA cycle or 4 tricarboxylic acid Choose.. cycle…

A: Question: Match the appropriate terms to their definitions Terms : TCA cycle or tricarboxylic acid…

Q: 14. There are main food rich in carbohydrates that provides us energy. All of the following are…

A: Introduction Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…

Q: The algal group from which green plants have probably arise, also show evidence that suggests this…

A: Algae are unicellular, photosynthetic, aquatic eukaryotic organisms that belong to the Protista…

Q: Assuming the Denisovans, Neanderthals, and humans were able to interbreed, what does this tell you…

A: Denisovans are group of extinct humans. They first identified based upon DNA sequences from…

Q: What kind of information What is the application is derived from polyphasic taxonomy? of polyamines…

A: Bacterial taxonomy is made up of the interconnected fields of classification, nomenclature, and…

Q: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…

A: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…

Q: 34. A 26-year-old woman is brought to the emergency department comatose 45 minutes following a motor…

A: Introduction An epidural hematoma (EDH) is a blood clot that occurs between your skull and the dura…

Q: Explain why genetic disorders caused by recessive alleles of X-linked genes appear more frequently…

A: In humans and other mammals, biological sex is determined by a pair of sex chromosomes: XY in males…

Q: why is RNA important in a physiology standpoint, and why is it important to know about this for…

A: RNA is Ribose nucleic acid. Its main building block is a nucleotide which is made up of a ribose…

Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…

A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…

Q: 38. A 67-year-old man who is being treated for a lesion in his spinal cord cannot feel the…

A: The spinal cord is part of the central nervous system and is majorly seen as the processing center…

Q: Explain the distinction between science and technology and discuss the need for such a distinction…

A: following is a brief distinction between science and tecnhology:-

Q: Place the steps regarding fat digestion and absorption in the correct order. The abbreviation TAG is…

A: Introduction Digestion is the process of breakdown down food into smaller particles that can be…

Q: 8 7 6 5 2 3 II I-1 1-2 2 1 2 3 4 5 6 7 8 [= II-1 11-2 11-4 II-5 11-6 II-7 II-8 11-3

A: Pedigree - Pedigree analysis is a chart that represents a family tree, which displays the members…

Q: Describe the location and structure of the different tissue types (epithelial, muscle, nervous,…

A: Note: As you have asked multiple questions, we are instructed to answer only one. Please repost the…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: How does genetic therapy differ from traditional methods of treating a disease? a. It targets the…

A: Gene therapy is the modern approach to treat a disease from the root of its occuarance. Traditional…

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: Ribosomal Intergenic Spacer signifies the intergenic region between the small and large subunits of…

Q: Look at the pedigree below and answer the following questions related to the human genetic trait…

A: A pedigree or family tree is made up of symbols and lines that indicates or represents genetic…

Concept explainers

Archaeal cell structure

Bacteria and archaea are two different prokaryotic domains that, along with eukarya, make up the three domains of life. Archaeal organisms can be found all over the biosphere. Many genera are extremophiles, meaning they thrive in extreme environments such as extremely high temperatures, high salinity, or pH extremes. Bacterial and archaeal cells are characterized by the absence of a nucleus and membrane-bound organelles.

Question

a. Double stranded DNA

b. Single stranded DNA

c. Messenger RNA

d. Double stranded RNA

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2 Explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How do amino acids in DNA-binding proteins interact with DNA? a. By forming covalent bonds with DNA bases b. By forming hydrogen bonds with DNA bases c. By forming covalent bonds with DNA sugars
How are nucleotides connected to each other in a single strand of DNA? A. The nitrogenous bases and acids link the separate nucleotides into a chain. B. The phosphate group of one nucleotide binds to the sugar on the next nucleotide. C. The hydroxy group of one nucleotide stabilizes the phosphate group of the adjacent nucleotide. D. The sugar of one nucleotide binds directly to the sugar of the adjacent nucleotide.
Suppose a region of DNA is 100 bp long. How many unique sequences could it potentially represent? A) 1004 B) 4100 C) 400 D) 4,000 E) 10,000
What is DNA polymerase? A. An enzyme that corrects mutations that arise during the replication of DNA B. An enzyme that seals any gaps that remain between bases of replicating strands of DNA C. Short, single strand of DNA that base-pairs with a specific DNA sequence D. An enzyme that carries out DNA replication
Refer to Figure 2 and compare this with the DNA model in Figure 1. a. In what ways are they similar? b. In what ways are they different? c. What is the biological significance of such differences? Why is the DNA referred to as the genetic material?
Within the Central Dogma, what is the primary function of DNA? a. make proteins b. preserve nuclear integrity c. maintain the genetic information d. keep a boundary between RNA and Protein
What is the role of Sodium Iodidee in DNA isolation? A. Solubilization of phospholipids B Precipitation of DNA C Destroy hydrogen bonding network in solvent D Precipitation of cel wall and cell membrane
Suppose you had a method of cutting DNA at specific sequences of nucleotides. how many nucleotides long (on average) would such a sequence have to be in order to make just one cut in a bacterial genome of 3 × 106 nucleotide pairs?
The figure below shows a polynucleotide:a) Label the 5' and the 3' end of the sequenceb) If a nucleotide were added to this polynucleotide, which end would it be added to?c) Is this an RNA or DNA strand? How do you know?
What do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA together? a.) an amino acid sequence b.) DNA ligase c.) restriction enzymes d.) mRNA
What is DNA polymerase? a.An enzyme that carries out DNA replication b.Short, single strand of DNA that base-pairs with a specific DNA sequence c.An enzyme that corrects mutations that arise during the replication of DNA d.An enzyme that seals any gaps that remain between bases of replicating strands of DNA
The molecule DNA is important to biological systems because a. it can be replicated. b. it encodes the information for making a new individual. c. it forms a complex, double-helical structure. d. nucleotides form genes.