The protein illustrated below was isolated from a superhuman being. Scientists theorized that it was the source of power of its power. Give the name of the protein using the three letter symbol.

Q: Name a disease treated with a protein produced by genetically engineered microorganisms.

A: Genetically modified organisms (GMO) are those organisms whose genetic sequences are changed by…

Q: You are a molecular biologist studying a defective human protein that is known to be the cause of a…

A: A disease caused by an uncontrolled division of abnormal cells in a part of the body.

Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is…

Q: Which of the following protein-microsome arrangements below fits with the data above?

A: Microsomes are vesicles with size varying from 20-200nm and released from the endoplasmic reticulum…

Q: Which of the following point mutations is likely to be the worst for an organism if they happened in…

A: Mutation is a change in genetic sequence or genomic sequence of an organism. This change can be…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: What is the structure being described? b. What is the chemical composition of this structure? c.…

A: A bacteria is a prokaryotic organism that it has a simple genetic material and the cellular…

Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…

A: Central dogma  is the process in which RNA is produced from the DNA (transcription) and amino acid…

Q: In an experiment of egg white and calamansi juice in protein denaturation, what will happen?

A: Proteins are one of the  most important metabolites in living organisms, which is almost present in…

Q: Let's imagine: an alien with prokaryotic cells wants to destroy an infection caused by human cells.…

A: While designing drugs the main concern is to target the pathogenic cells specifically.

Q: Explain the application of protein engineering in medicine? Please answer at your own words, please.

A: Protein engineering is the modification of pre-occurring proteins by changing the amino acid…

Q: Which one of the following statements is true? Select one: O a. Each gene codes for three proteins O…

A: In order to form proteins, DNA codes for m RNA and t RNA through the process of transcription. Both…

Q: List the 4 types of protein modification and describe each in 1 sentence

A: Protein modification refer to any change in the chemical composition of proteins following…

Q: “Through protein engineering, we can get a protein with better robustness, & better stability”-…

A: Proteins are biomolecules that play a variety of functions, including structural support, as…

Q: You are a molecular biologist studying a defective human protein that is known to be a cause of a…

A: It is given in the question that the protein from the cancer patient differs in almost every amino…

Q: between gene and protein was first articulated by Beadle & Tatum, who proposed the one-gene,…

A: The one gene–one enzyme theory proposes that genes work by making enzymes, with each gene producing…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation?  16S…

A: Gene is a hereditary units which is exhibited on the chromosome . Gene expression is a phenomenon in…

Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…

A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…

Q: Which of the following describes a silent mutation that is undetectable in the final protein…

A: Mutation can be outlined as the variation within the sequence of DNA. It generally occurs as a…

Q: When a protein is denatured using heat Select one: a. its C-terminal will change. b. its tertiary…

A: Proteins are amino acid chains that are primarily joined by peptide bonds. However, these primary…

Q: The two large subunits of the E. coli RNA polymerase are called B and B' are related to the large…

A: Ribosomes are tiny particles made up of RNA and associated proteins that are responsible for protein…

Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…

A: Proteins are amazing molecules that make everything simple inside the cell. Protein molecules are…

Q: An American biochemist Erwin Chargaff discovered that in the cells of all organisms he studied, the…

A: Introduction :- All living things are made up of cells, which are the basic building blocks. There…

Q: Which of the following organisms incorporates peptides along with carbohydrates in its cell wall…

A: Cell wall is a protective layer outside the cell which protect cell stresses. It is the outer…

Q: Changing only the R-group on a penicillin-family antibiotic could have many consequences. Which of…

A: Penicillin (PCN) belongs to a group of antibiotics used to treat a huge range of bacterial…

Q: Why is knowing the protein sequence important?

A: All proteins in all three classes of organisms i.e bacterial, archaeal, and eukaryotic—are…

Q: Your lab partner tells you proteins are used to make enzymes, you say, no enzymes are used to make…

A: Introduction  Amino acids are the building blocks of proteins. The building blocks of life are amino…

Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…

A: The bond between nitrogen and alpha carbon (N-Calpha) in amino acid is known as phi bond. On the…

Q: Which of the following types of mutations would be predicted to harm an organism? explain your…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: multiple codons (genetic code triplets)

A: Cells decode mRNAs by investigating their codons. Every codon indicates a type of amino acid, or, at…

Q: The information contained in the sequence and structure of a protein can Be used to synthesize RNA…

A: The information contained in the sequence and structure of the proteins can be used to…

Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…

A: Introduction DNA:-  (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…

Q: At high salt concentration, proteins are less soluble. Changing the solubility of a protein based on…

A: Salting out procedure can be used to precipitate large biomolecules, such as proteins or DNA. The…

Q: A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in…

A: Correct answer :-  5' TTT-CCC-AAA-GGG-TTT-CCC  ( option B is correct.)

Q: When you make a gene to put into another organism, you need to combine the __________ sequence at…

A: Answer: The transfer of new gene into another organism usually by vectors such as plasmids, and…

Q: Given the following information, which protein would be most difficult to isolate from protein X…

A: Salting out is a method of separation of protein mixtures that is based on protein solubility. The…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: What would the effect be on the protein you made if you made a mistake when you transcribed the DNA…

A: Point mutation  Change of one base of nucleotide in DNA sequence is known as point mutation.

Q: Which statement about zinc is true?   Zinc is an enzyme cofactor for DNA polymerase.   Zinc finger…

A: Zinc is a mineral which is involved in many important functions in the body.

Q: Explain the process of Transcription and Translation. List three antibiotics and explain how these…

A: All the genetic information needed by the cell to perform its activities is encoded and stored in…

Q: Explain the methods of Protein Engineering?  Please answer at your own words.

A: Protein engineering is the change in protein structure to suit the needs. It may be used in…

Q: Which of the following statements about the genetic code are true?  (Hint:  There are 2 correct…

A: The process of translation refers to the production of proteins by decoding the mRNA sequence. The…

Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete…

A: DNA and RNA are nucleic acids composed of nucleotide units. Each nucleotide is composed of a pentose…

Q: What are the differences between protein synthesis in prokaryote and eukaryote? Make a table

A: Protein synthesis is a process in which cells make proteins that are responsible for cellular…

Q: protein analysis, where protein particles go

A: Introduction:  Proteins, also known as polypeptides, are organic compounds made up of amino acids.…

Q: The protein illustrated below was isolated from a superhuman being. Scientists theorized that it was…

A: Proteins are made up of small units or building blocks. These units are called amino acids.…

Q: Consider a protein that has all the 20 common amino acids in its primary sequence. Explain three…

A: A protein is a polymer of amino acids. Each amino acid is made up of a side chain, a carboxylic acid…