The information contained in the sequence and structure of a protein can Be used to synthesize RNA Be used to synthesize DNA Be used to synthesize more protein Not be used to synthesize nucleic acids Carry a cell's genotype Be read with a good pair of reading glasses.:-)

The information contained in the sequence and structure of a protein can Be used to synthesize RNA Be used to synthesize DNA Be used to synthesize more protein Not be used to synthesize nucleic acids Carry a cell's genotype Be read with a good pair of reading glasses.:-)

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 6SQ

See similar textbooks

Related questions

Q: What molecule catalyzes the formation of proteins

A: The protein synthesis process is a process where amino acids are formed by reading the frame of the…

Q: Complete the DNA and RNA sequencing for the translation and creation of proteins.

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: The correct order of genetic information transfer within biological systems is BEST described as RNA…

A: The correct order is best described according to central dogma given by Francis Crick. According to…

Q: Answer for 1 ,2,and 3 asap

A: Answer given in steps 2 onwards. Please find the attachment. Thank you

Q: mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: The protein illustrated below was isolated from a superhuman being. Scientists theorized that it was…

A: The given protein is composed of some particular amino acids among the 20 standard amino acids in a…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: Which one of the following statements is true? Select one: O a. It takes three genes to code for one…

A: Gene can be defined as the segment of DNA. It contains information about the genetic characteristic…

Q: During transcription, an mRNA molecule is formed: True False inside the nucleus that is…

A: The central dogma of life is the biological information that flows from DNA to RNA and finally…

Q: A few genes produce regulatory molecules that help the cell assemble proteins. The journey from gene…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: Which one of the following statements is true? Select one: O a. Each gene codes for three proteins O…

A: In order to form proteins, DNA codes for m RNA and t RNA through the process of transcription. Both…

Q: Which of the following best describes the central dogma of molecular biology? A) mRNA is…

A: In molecular biology, a central dogma is an illustration showing the flow of genetic information…

Q: Which of the following experimental results was NOT evidence that DNA is the genetic molecule rather…

A: Eukaryotes have linear DNA which is a double-chained helically twisted structure. it has a…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon,…

A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: The function of DNA is to _______ while the function of RNA is to ___________. store information…

A: The two main types of nucleic acids found in all living cells are DNA and RNA. Both are made from…

Q: What happens in translocation during protein synthesis? * Answer in 3-5 sentences only. Your answer…

A: Carbohydrates, proteins, lipids, and nucleic acids are the four major macromolecules found in all…

Q: Compare and contrast: TRANSCRIPTION and TRANSLATION Give 2 similarities and 2 differences. Be…

A: Introduction DNA acts as a genetic material in our body. DNA contains gene or the basic unit of…

Q: Proteins are not suitable to be the genetic molecules within cells because they are large organic…

A: The genetic materials are responsible for the information that is carried out to offspring. Genetic…

Q: Classify each description as a property of DNA only, RNA only, or both DNA and RNA. DNA only RNA…

A: DNA is the genetic material which resides in nucleus. So, they are passed from existing cells to new…

Q: Fill in the blanks: In electrophoresis, an electric current is applied to the matrix of a gel-like…

A: Gel electrophoresis is a technique that is utenly used in molecular biology laboratories. It…

Q: Segments of DNA that code for a protein are called genes are DNA wrapped up with proteins. There are…

A: Ribonucleic acid (RNA) is a chemical found in almost all living creatures and viruses. Nucleotides…

Q: What is a nucleoid? a structure that is responsible for the production of ribosomes in eukaryotic…

A: Nucleus, is the membrane-enclosed organelle within a cell that contains the chromosomes.

Q: The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the…

A: Genes are the basis of genetic inheritance and they store genetic information passed on from the…

Q: gene is a small section of usually found on a Each gene codes for a sequence of which are joined…

A: this description is all about gene expression. Gene expression means how the information present on…

Q: Complete the DNA and RNA sequencing for the translation and creation of proteins

A: The sequence of DNA RNA are used to create amino acids which in turn code for proteins.

Q: What are the important types MRNA molecule or genetic sequence that you can target to design a drug?…

A: Delivery person RNA (mRNA) could be a single-stranded RNA atom that's complementary to one of the…

Q: An antibiotic is: a- A disease causing microorganism. b- A protein that inactivates a foreign…

A: Actibiotics are chemical substances . It is produced by a microorfanisms that can kill or…

Q: Messenger RNA (MRNA) can be best described as: * A Chromosome that is only present in prokaryotes…

A: Messenger RNA or mRNA are single stranded RNA molecules that carries genetic information from the…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: For each of the following sentences, fill in the blanks with the best word or phrase selected from…

A: a) transcription b) mRNA c) t-RNA

Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: Basis of Comparison DNA RNA 1. Number of strands 2. Location in the cell 3. Type of sugar 4.…

A: DNA is the genetic material in all living organisms that is responsible for the production of RNA by…

Q: What is a gene ? A- A molecule of DNA , which is transformed into a protein to be used by the cell…

A: Answer. Mendel used the term factor for a gene. Johannsen in 1909 named these units as Genes. Gene…

Q: When proteins are being built, RNA bases are read in sets of three. What are these sets called?…

A: Proteins are synthesized through the process called translation. The information stored in the DNA…

Q: The flow of genetic Information Includes two stages : transcription, the transfer of the Information…

A: The Central Dogma theory is the basis of any life, which comprises of three stages - Replication,…

Q: A polyribosome is making several copies of the same protein molecule. a.True b. False Genes…

A: a polyribosome is a struture formed by more than one ribosome such that they help in translating the…

Q: Which biomolecule contains Deoxyribonucleic acid; a sequence of bases that makes hereditary code;…

A: There are two types of genetic material in plants and animals. They are DNA and RNA, deoxyribose…

Q: The sequence of subunits in a DNA molecule is more important to its function than the number of…

A: DNA instructions are translated into functional products using a 'Central Dogma'. The central dogma…

Q: A set of cells that host various DNA fragments collectively representing an organism’s entire set of…

A: DNA molecules are present in the cells of living beings and regulate the genetic traits.

Q: Which of the following is NOT true of a typical human mRNA? - It is double-stranded. - It…

A: The mRNA in humans does contain uracil which replaces thymine as the complementary nucleotide to…

Q: Which of the following choices best match the blank? Three-nucleotide segments of RNA called…

A: Amino acids are the monomers or structural units that are responsible for protein formation. The…

Q: What must be translated using the Genetic Code Table to decode a specific type of amino acid that…

Q: How can you get more than one protein from one gene? Alternative splicing/multiple mRNAs One…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: Place the steps needed to create a protein in a human cell in order. Place the initial step at the…

A: The gene expression involve transcription and translation that are ultimately responsible for the…

Q: RNA contains the sugar Group of answer choices ribose. deoxyribose. glucose. phosphate.

A: While it is normally synthesized in the nucleus, ribonucleic acid (RNA) is located predominantly in…

Q: Which type of RNA best fits each of the statements below, respectively? MRNA, FRNA, MRNA, TRNA,…

A: RNA or the ribonucleic acid is a type of nucleic acid that is present in the cell usually…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

The information contained in the sequence and structure of a protein can
Be used to synthesize RNA
Be used to synthesize DNA
Be used to synthesize more protein
O Not be used to synthesize nucleic acids
O Carry a cell's genotype
Be read with a good pair of reading glasses.:-)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 19 options: LINE & SINE/Alu sequences LINE sequences & IS elements transposons & LINE sequences transposons & retrotransposons SINE & Alu sequences
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
The following fragment of DNA is from the template strand. First determine the amino acids of the protein encoded by this sequence by using the table at the end of this document. Then give the altered amino acid sequence of the proteins that will be found in each of the following mutations: 3’ – TAC AAG GCT CTA TTT GCC ACA ATC – 5’ The nucleotides are numbered 1-24 from left to right. Mutant 1: A transition at nucleotide 9 Mutant 2: A transition at nucleotide 11 Mutant 3: A T to A transversion at nucleotide 15 Mutant 4: A one-nucleotide deletion at nucleotide 7 Mutant 5: A transition at nucleotide 13 Mutant 6: An addition of GGA after nucleotide 6
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’
“Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”
You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted into a plasmid vector. The polylinker of thisvector includes recognition sites for the enzymesEcoRI (5′ G^AATTC 3′) and BamHI (5′ G^GATCC3′). (The ^ symbolizes the cut site in the DNA.) PCRprimers that could amplify the fragment of humanDNA are: 5′ GCTACTTCGCGTATTCCA 3′ and5′ CCCAAGTCCTAGCCGATA 3′.a. Describe in detail how these primers would need tobe modified to create a fragment of the human genome flanked by EcoRI sticky ends so that thisfragment could be cloned easily into the plasmidvector. You will need to consider the fact that mostrestriction enzymes, including EcoRI, cannot cutDNA if the restriction site is directly at the end ofthe DNA molecule; the restriction enzyme recognition site must be at least six base pairs distant fromthe end.b. Describe a potential feature of the PCR-amplifiedregion of the human genome that could prevent youfrom using the strategy you described in…
Which transposable element is used to introduce foreignDNA into the fruit fly Drosophila melanogaster?a. Ac elementb. P elementc. Alu elementd. Composite transposons
e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?
In nature, the vast majority of individuals within a species have unique genetic codes. In the last few decades, human geneticists have discovered ways to artificially duplicate a genetic code. Two organisms with identical genetic codes might be the result ofA. CloningB. MutationC. Coevolution
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 40 options: LINE & SINE/Alu sequences LINE sequences & IS elements SINE & Alu sequences transposons & retrotransposons jumping genes & deletors
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)